Mutagenetix > Incidental Mutations

Incidental Mutation 'R7861:Kifc3'

607523

Institutional Source

Beutler Lab

Gene Symbol

Kifc3

Ensembl Gene

ENSMUSG00000031788

Gene Name

kinesin family member C3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

95099828-95202812 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to A at 95107537 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000212968] [ENSMUST00000213004]

Predicted Effect

probably null
Transcript: ENSMUST00000034240

SMART Domains

Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
low complexity region	33	46	N/A	INTRINSIC
coiled coil region	100	360	N/A	INTRINSIC
coiled coil region	393	430	N/A	INTRINSIC
KISc	441	774	3.15e-158	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169353

SMART Domains

Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	33	223	N/A	INTRINSIC
coiled coil region	256	293	N/A	INTRINSIC
KISc	304	637	3.15e-158	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169748

SMART Domains

Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

Domain	Start	End	E-Value	Type
coiled coil region	34	324	N/A	INTRINSIC
coiled coil region	357	394	N/A	INTRINSIC
KISc	405	728	3.11e-148	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212424

Predicted Effect

probably benign
Transcript: ENSMUST00000212787

Predicted Effect

probably benign
Transcript: ENSMUST00000212968

Predicted Effect

probably null
Transcript: ENSMUST00000213004

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Brca1	A	T	11: 101,526,422	N295K	possibly damaging	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Etl4	A	G	2: 20,805,910	S1303G	probably benign	Het
Evpl	A	T	11: 116,228,069	Y627N	probably damaging	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Invs	A	T	4: 48,397,559	D378V	possibly damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pidd1	C	A	7: 141,440,142	W598L	probably damaging	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Kifc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00720:Kifc3	APN	8	95138016	missense	probably damaging	1.00
IGL01904:Kifc3	APN	8	95137957	missense	possibly damaging	0.81
IGL02019:Kifc3	APN	8	95107540	splice site	probably benign
IGL02090:Kifc3	APN	8	95102480	missense	probably damaging	1.00
IGL02355:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02362:Kifc3	APN	8	95109879	missense	probably damaging	1.00
IGL02620:Kifc3	APN	8	95109954	missense	probably damaging	0.98
IGL02720:Kifc3	APN	8	95108365	missense	probably benign	0.00
IGL03030:Kifc3	APN	8	95102412	missense	probably damaging	1.00
IGL03327:Kifc3	APN	8	95108432	missense	probably damaging	1.00
IGL03390:Kifc3	APN	8	95108613	missense	probably damaging	1.00
R0233:Kifc3	UTSW	8	95101472	splice site	probably null
R0281:Kifc3	UTSW	8	95103460	missense	probably damaging	1.00
R0302:Kifc3	UTSW	8	95103470	missense	possibly damaging	0.50
R0619:Kifc3	UTSW	8	95102665	missense	probably benign	0.13
R0731:Kifc3	UTSW	8	95105733	missense	probably damaging	1.00
R1017:Kifc3	UTSW	8	95105785	missense	probably damaging	0.99
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1147:Kifc3	UTSW	8	95137918	missense	probably damaging	1.00
R1257:Kifc3	UTSW	8	95105772	missense	probably damaging	0.98
R1472:Kifc3	UTSW	8	95137913	critical splice donor site	probably null
R1480:Kifc3	UTSW	8	95109887	missense	probably damaging	1.00
R1553:Kifc3	UTSW	8	95106542	missense	possibly damaging	0.67
R2071:Kifc3	UTSW	8	95108353	critical splice donor site	probably null
R2115:Kifc3	UTSW	8	95108713	missense	probably damaging	1.00
R3703:Kifc3	UTSW	8	95104028	splice site	probably benign
R3704:Kifc3	UTSW	8	95104028	splice site	probably benign
R3705:Kifc3	UTSW	8	95104028	splice site	probably benign
R4223:Kifc3	UTSW	8	95109982	missense	probably damaging	0.96
R4463:Kifc3	UTSW	8	95102116	missense	probably damaging	1.00
R4508:Kifc3	UTSW	8	95107420	splice site	probably null
R4980:Kifc3	UTSW	8	95126549	missense	probably benign
R5032:Kifc3	UTSW	8	95102726	missense	probably damaging	1.00
R5068:Kifc3	UTSW	8	95110216	missense	possibly damaging	0.54
R5421:Kifc3	UTSW	8	95109845	missense	probably damaging	0.99
R5556:Kifc3	UTSW	8	95108459	nonsense	probably null
R6845:Kifc3	UTSW	8	95108679	missense	probably benign	0.28
R7136:Kifc3	UTSW	8	95103449	missense	probably benign	0.10
R7196:Kifc3	UTSW	8	95106611	missense	probably benign	0.02
R7404:Kifc3	UTSW	8	95103464	missense	probably benign	0.02
R7441:Kifc3	UTSW	8	95137987	missense	probably benign	0.00
R7784:Kifc3	UTSW	8	95110692	critical splice donor site	probably null
R8440:Kifc3	UTSW	8	95109794	missense	possibly damaging	0.89
R8754:Kifc3	UTSW	8	95102396	missense	probably damaging	1.00
X0023:Kifc3	UTSW	8	95109298	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGCCACCATTGCACAGTAC -3'
(R):5'- GCAGCCAAGTACTCAGTCTC -3'

Sequencing Primer
(F):5'- TACCATGGCCAAGGAGCTTTG -3'
(R):5'- AGCCAAGTACTCAGTCTCTGGTC -3'

Posted On

2019-12-20