Incidental Mutation 'R7861:Wdr59'
ID 607524
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene Name WD repeat domain 59
Synonyms 5430401O09Rik
MMRRC Submission 045914-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7861 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 112175429-112248724 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112220912 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 207 (F207L)
Ref Sequence ENSEMBL: ENSMUSP00000034437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: F207L

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038193
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: F207L

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211981
AA Change: F207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,797,360 (GRCm39) I50F possibly damaging Het
Abcc3 T C 11: 94,248,075 (GRCm39) D1175G probably null Het
Accs C A 2: 93,666,077 (GRCm39) *503L probably null Het
Adgra2 A G 8: 27,604,485 (GRCm39) E520G probably damaging Het
Aldh7a1 C A 18: 56,681,525 (GRCm39) C215F probably benign Het
Apbb1ip A C 2: 22,706,990 (GRCm39) D9A unknown Het
Atad2 G A 15: 57,989,176 (GRCm39) A228V probably benign Het
Atp10a T C 7: 58,438,107 (GRCm39) S430P probably damaging Het
Atp1a3 T C 7: 24,700,573 (GRCm39) D6G unknown Het
Brca1 A T 11: 101,417,248 (GRCm39) N295K possibly damaging Het
Caly C A 7: 139,661,301 (GRCm39) probably benign Het
Ces1h A G 8: 94,084,053 (GRCm39) Y386H unknown Het
Col14a1 A G 15: 55,308,012 (GRCm39) D1044G unknown Het
Csf2rb A G 15: 78,233,357 (GRCm39) D888G probably damaging Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dhrs7b T A 11: 60,746,568 (GRCm39) L219Q probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dnah14 C T 1: 181,444,324 (GRCm39) P545S probably damaging Het
Dnajc24 A T 2: 105,832,380 (GRCm39) M1K probably null Het
Dusp12 C T 1: 170,702,095 (GRCm39) W301* probably null Het
Dyrk1a G T 16: 94,492,575 (GRCm39) G603* probably null Het
Eif4g1 T A 16: 20,498,452 (GRCm39) V403E probably benign Het
Epn3 T C 11: 94,387,100 (GRCm39) E90G probably damaging Het
Etl4 A G 2: 20,810,721 (GRCm39) S1303G probably benign Het
Evpl A T 11: 116,118,895 (GRCm39) Y627N probably damaging Het
Fbxw25 A T 9: 109,493,625 (GRCm39) L22* probably null Het
Fcamr T A 1: 130,742,375 (GRCm39) N587K probably benign Het
Fgd6 A G 10: 93,939,193 (GRCm39) N946S probably benign Het
Fndc3b A T 3: 27,523,148 (GRCm39) I477N possibly damaging Het
Grifin C T 5: 140,550,280 (GRCm39) A54T probably benign Het
Gtf2b A G 3: 142,487,105 (GRCm39) I180M probably damaging Het
Invs A T 4: 48,397,559 (GRCm39) D378V possibly damaging Het
Itgb6 T C 2: 60,458,788 (GRCm39) E378G probably damaging Het
Khdc1a T C 1: 21,420,623 (GRCm39) I81T possibly damaging Het
Kif20b T A 19: 34,917,322 (GRCm39) D617E probably damaging Het
Kifc3 T A 8: 95,834,165 (GRCm39) probably null Het
Kirrel3 C T 9: 34,931,419 (GRCm39) H403Y possibly damaging Het
Klf15 G A 6: 90,443,820 (GRCm39) V132I probably benign Het
Kmt2a A G 9: 44,730,031 (GRCm39) S3429P unknown Het
Lama1 T G 17: 68,116,216 (GRCm39) L2361R Het
Lrp1b T C 2: 40,587,570 (GRCm39) D3895G Het
Mcoln3 A C 3: 145,830,546 (GRCm39) E92A possibly damaging Het
Myo3b T C 2: 69,939,032 (GRCm39) M135T probably damaging Het
Mysm1 A G 4: 94,835,204 (GRCm39) *820Q probably null Het
Ncoa7 A G 10: 30,567,056 (GRCm39) S541P probably benign Het
Nup54 T C 5: 92,578,952 (GRCm39) T33A unknown Het
Or10al2 C A 17: 37,983,408 (GRCm39) Q165K possibly damaging Het
Or13a17 T G 7: 140,271,484 (GRCm39) I222S probably damaging Het
Or1s2 T C 19: 13,758,810 (GRCm39) V276A possibly damaging Het
Or4k42 T A 2: 111,320,369 (GRCm39) I45F probably damaging Het
Or51a5 T A 7: 102,771,899 (GRCm39) I27F probably benign Het
Otud6b A G 4: 14,826,414 (GRCm39) C18R probably benign Het
Pde4d A G 13: 110,071,858 (GRCm39) E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pidd1 C A 7: 141,020,055 (GRCm39) W598L probably damaging Het
Pira2 A T 7: 3,847,543 (GRCm39) C49S probably damaging Het
Pramel11 T C 4: 143,624,288 (GRCm39) M70V possibly damaging Het
Prdx1 T G 4: 116,550,935 (GRCm39) D135E probably benign Het
Rab15 T A 12: 76,849,903 (GRCm39) Y88F probably damaging Het
Rem2 C A 14: 54,715,256 (GRCm39) H144Q probably damaging Het
Sel1l3 T C 5: 53,301,406 (GRCm39) D737G probably damaging Het
Srd5a3 C T 5: 76,295,666 (GRCm39) Q119* probably null Het
Suclg2 G T 6: 95,571,703 (GRCm39) Q120K probably benign Het
Tacc2 T A 7: 130,227,161 (GRCm39) M1282K probably benign Het
Tbc1d5 T A 17: 51,063,720 (GRCm39) Q620L probably damaging Het
Tdrd3 G T 14: 87,709,590 (GRCm39) A91S probably damaging Het
Thsd7b T A 1: 130,087,435 (GRCm39) F1184Y probably benign Het
Trim28 T A 7: 12,762,339 (GRCm39) V321E possibly damaging Het
Trim5 C A 7: 103,915,675 (GRCm39) probably null Het
Ugt2b37 A T 5: 87,390,299 (GRCm39) Y382* probably null Het
Usp40 C T 1: 87,909,852 (GRCm39) G534D probably damaging Het
Usp53 A T 3: 122,728,112 (GRCm39) H823Q probably benign Het
Vmn2r12 T A 5: 109,235,829 (GRCm39) M508L probably benign Het
Vmn2r56 T A 7: 12,449,351 (GRCm39) I296F probably benign Het
Vps13a T C 19: 16,632,668 (GRCm39) S2563G probably damaging Het
Zan A G 5: 137,405,295 (GRCm39) S3777P unknown Het
Zfp277 T C 12: 40,365,880 (GRCm39) N530D possibly damaging Het
Zfp365 G A 10: 67,745,749 (GRCm39) R10W probably damaging Het
Zfp384 A T 6: 125,013,288 (GRCm39) H452L probably damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve28 A T 5: 34,374,487 (GRCm39) L509Q probably damaging Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 112,185,368 (GRCm39) missense probably damaging 0.98
IGL01330:Wdr59 APN 8 112,208,565 (GRCm39) missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 112,227,706 (GRCm39) missense probably benign 0.23
IGL02306:Wdr59 APN 8 112,219,365 (GRCm39) missense probably damaging 1.00
IGL03027:Wdr59 APN 8 112,188,824 (GRCm39) missense probably damaging 1.00
IGL03057:Wdr59 APN 8 112,202,750 (GRCm39) missense probably damaging 1.00
IGL03204:Wdr59 APN 8 112,212,002 (GRCm39) missense probably benign 0.05
electron UTSW 8 112,185,270 (GRCm39) missense probably benign 0.00
photon UTSW 8 112,187,445 (GRCm39) missense probably benign 0.00
R0056:Wdr59 UTSW 8 112,207,239 (GRCm39) splice site probably benign
R0096:Wdr59 UTSW 8 112,231,005 (GRCm39) missense probably damaging 1.00
R0096:Wdr59 UTSW 8 112,231,005 (GRCm39) missense probably damaging 1.00
R0440:Wdr59 UTSW 8 112,207,172 (GRCm39) small deletion probably benign
R0452:Wdr59 UTSW 8 112,248,604 (GRCm39) missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 112,213,629 (GRCm39) critical splice acceptor site probably null
R0501:Wdr59 UTSW 8 112,185,579 (GRCm39) missense possibly damaging 0.90
R0526:Wdr59 UTSW 8 112,207,172 (GRCm39) small deletion probably benign
R0534:Wdr59 UTSW 8 112,207,172 (GRCm39) small deletion probably benign
R0601:Wdr59 UTSW 8 112,207,172 (GRCm39) small deletion probably benign
R1144:Wdr59 UTSW 8 112,213,576 (GRCm39) missense probably benign 0.09
R1415:Wdr59 UTSW 8 112,225,228 (GRCm39) missense probably damaging 1.00
R1571:Wdr59 UTSW 8 112,177,682 (GRCm39) missense probably damaging 0.98
R1661:Wdr59 UTSW 8 112,205,994 (GRCm39) missense probably damaging 1.00
R1665:Wdr59 UTSW 8 112,205,994 (GRCm39) missense probably damaging 1.00
R1839:Wdr59 UTSW 8 112,211,972 (GRCm39) missense probably benign
R1856:Wdr59 UTSW 8 112,202,813 (GRCm39) missense probably damaging 1.00
R1872:Wdr59 UTSW 8 112,185,649 (GRCm39) missense probably damaging 1.00
R1921:Wdr59 UTSW 8 112,213,582 (GRCm39) nonsense probably null
R1965:Wdr59 UTSW 8 112,177,709 (GRCm39) missense probably damaging 1.00
R1966:Wdr59 UTSW 8 112,177,535 (GRCm39) missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 112,185,270 (GRCm39) missense probably benign 0.00
R2019:Wdr59 UTSW 8 112,193,425 (GRCm39) missense probably damaging 1.00
R4245:Wdr59 UTSW 8 112,216,996 (GRCm39) missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 112,193,419 (GRCm39) critical splice donor site probably null
R4820:Wdr59 UTSW 8 112,207,446 (GRCm39) missense probably benign 0.19
R5198:Wdr59 UTSW 8 112,208,620 (GRCm39) missense probably benign 0.00
R5540:Wdr59 UTSW 8 112,211,816 (GRCm39) missense possibly damaging 0.84
R5571:Wdr59 UTSW 8 112,192,463 (GRCm39) missense probably damaging 1.00
R6166:Wdr59 UTSW 8 112,199,293 (GRCm39) missense probably damaging 1.00
R6732:Wdr59 UTSW 8 112,227,684 (GRCm39) missense probably damaging 1.00
R6767:Wdr59 UTSW 8 112,202,733 (GRCm39) missense probably damaging 1.00
R6823:Wdr59 UTSW 8 112,185,672 (GRCm39) missense possibly damaging 0.95
R6841:Wdr59 UTSW 8 112,223,512 (GRCm39) missense probably damaging 1.00
R6888:Wdr59 UTSW 8 112,177,675 (GRCm39) missense probably benign 0.00
R6974:Wdr59 UTSW 8 112,187,420 (GRCm39) missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 112,187,445 (GRCm39) missense probably benign 0.00
R7066:Wdr59 UTSW 8 112,192,477 (GRCm39) missense probably benign 0.07
R7154:Wdr59 UTSW 8 112,185,367 (GRCm39) missense
R7176:Wdr59 UTSW 8 112,219,388 (GRCm39) missense
R7286:Wdr59 UTSW 8 112,192,494 (GRCm39) missense
R7332:Wdr59 UTSW 8 112,220,986 (GRCm39) missense
R7537:Wdr59 UTSW 8 112,217,001 (GRCm39) missense
R7614:Wdr59 UTSW 8 112,219,394 (GRCm39) missense
R7758:Wdr59 UTSW 8 112,207,117 (GRCm39) missense
R7800:Wdr59 UTSW 8 112,248,570 (GRCm39) missense
R8137:Wdr59 UTSW 8 112,212,011 (GRCm39) missense
R8726:Wdr59 UTSW 8 112,223,466 (GRCm39) missense
R8942:Wdr59 UTSW 8 112,211,808 (GRCm39) missense probably benign
R9318:Wdr59 UTSW 8 112,177,700 (GRCm39) missense
X0026:Wdr59 UTSW 8 112,205,972 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TACACCATCGCATCTGCTG -3'
(R):5'- ATTGTTAGGGTCCCCTCAGTG -3'

Sequencing Primer
(F):5'- ATCGCATCTGCTGGTCAG -3'
(R):5'- AGTGCCCAGTACACCGTTC -3'
Posted On 2019-12-20