Mutagenetix > Incidental Mutation

Incidental Mutation 'R7861:Brca1'

607534

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

045914-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101526422 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 295 (N295K)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290] [ENSMUST00000142086] [ENSMUST00000191198]

AlphaFold

P48754

Predicted Effect

possibly damaging
Transcript: ENSMUST00000017290
AA Change: N295K

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: N295K

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142086

SMART Domains

Protein: ENSMUSP00000139813
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
RING	24	64	8.6e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191198

SMART Domains

Protein: ENSMUSP00000139737
Gene: ENSMUSG00000017146

Domain	Start	End	E-Value	Type
Pfam:EIN3	1	146	3.5e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Etl4	A	G	2: 20,805,910	S1303G	probably benign	Het
Evpl	A	T	11: 116,228,069	Y627N	probably damaging	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Invs	A	T	4: 48,397,559	D378V	possibly damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kifc3	T	A	8: 95,107,537		probably null	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pidd1	C	A	7: 141,440,142	W598L	probably damaging	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4571:Brca1	UTSW	11	101517366	missense	probably benign	0.00
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19
R9072:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9073:Brca1	UTSW	11	101502480	critical splice donor site	probably null
R9486:Brca1	UTSW	11	101523694	missense	probably benign	0.00
R9505:Brca1	UTSW	11	101512766	missense	probably benign	0.00
R9616:Brca1	UTSW	11	101525857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAGGGCACAGACTTTGC -3'
(R):5'- GAGTTTTCTGAGGGCATAAGAAAC -3'

Sequencing Primer
(F):5'- CACAGACTTTGCGGGTGAGTC -3'
(R):5'- TTCTGAGGGCATAAGAAACATTGAAC -3'

Posted On

2019-12-20