Mutagenetix > Incidental Mutations

Incidental Mutation 'R7861:Evpl'

607535

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7861 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

116220559-116238077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 116228069 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 627 (Y627N)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037007
AA Change: Y627N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: Y627N

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016H13Rik	T	A	5: 103,649,494	I50F	possibly damaging	Het
Abcc3	T	C	11: 94,357,249	D1175G	probably null	Het
Accs	C	A	2: 93,835,732	*503L	probably null	Het
Adgra2	A	G	8: 27,114,457	E520G	probably damaging	Het
Aldh7a1	C	A	18: 56,548,453	C215F	probably benign	Het
Apbb1ip	A	C	2: 22,816,978	D9A	unknown	Het
Atad2	G	A	15: 58,125,780	A228V	probably benign	Het
Atp10a	T	C	7: 58,788,359	S430P	probably damaging	Het
Atp1a3	T	C	7: 25,001,148	D6G	unknown	Het
Brca1	A	T	11: 101,526,422	N295K	possibly damaging	Het
Caly	C	A	7: 140,081,388		probably benign	Het
Ces1h	A	G	8: 93,357,425	Y386H	unknown	Het
Col14a1	A	G	15: 55,444,616	D1044G	unknown	Het
Csf2rb	A	G	15: 78,349,157	D888G	probably damaging	Het
Cux1	T	C	5: 136,252,604	E568G	possibly damaging	Het
Cyhr1	C	T	15: 76,648,186	D241N	probably benign	Het
Dhrs7b	T	A	11: 60,855,742	L219Q	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dnah14	C	T	1: 181,616,759	P545S	probably damaging	Het
Dnajc24	A	T	2: 106,002,035	M1K	probably null	Het
Dusp12	C	T	1: 170,874,526	W301*	probably null	Het
Dyrk1a	G	T	16: 94,691,716	G603*	probably null	Het
Eif4g1	T	A	16: 20,679,702	V403E	probably benign	Het
Epn3	T	C	11: 94,496,274	E90G	probably damaging	Het
Etl4	A	G	2: 20,805,910	S1303G	probably benign	Het
Fbxw25	A	T	9: 109,664,557	L22*	probably null	Het
Fcamr	T	A	1: 130,814,638	N587K	probably benign	Het
Fgd6	A	G	10: 94,103,331	N946S	probably benign	Het
Fndc3b	A	T	3: 27,468,999	I477N	possibly damaging	Het
Grifin	C	T	5: 140,564,525	A54T	probably benign	Het
Gtf2b	A	G	3: 142,781,344	I180M	probably damaging	Het
Invs	A	T	4: 48,397,559	D378V	possibly damaging	Het
Itgb6	T	C	2: 60,628,444	E378G	probably damaging	Het
Khdc1a	T	C	1: 21,350,399	I81T	possibly damaging	Het
Kif20b	T	A	19: 34,939,922	D617E	probably damaging	Het
Kifc3	T	A	8: 95,107,537		probably null	Het
Kirrel3	C	T	9: 35,020,123	H403Y	possibly damaging	Het
Klf15	G	A	6: 90,466,838	V132I	probably benign	Het
Kmt2a	A	G	9: 44,818,734	S3429P	unknown	Het
Lama1	T	G	17: 67,809,221	L2361R		Het
Lrp1b	T	C	2: 40,697,558	D3895G		Het
Mcoln3	A	C	3: 146,124,791	E92A	possibly damaging	Het
Myo3b	T	C	2: 70,108,688	M135T	probably damaging	Het
Mysm1	A	G	4: 94,946,967	*820Q	probably null	Het
Ncoa7	A	G	10: 30,691,060	S541P	probably benign	Het
Nup54	T	C	5: 92,431,093	T33A	unknown	Het
Olfr118	C	A	17: 37,672,517	Q165K	possibly damaging	Het
Olfr1290	T	A	2: 111,490,024	I45F	probably damaging	Het
Olfr1496	T	C	19: 13,781,446	V276A	possibly damaging	Het
Olfr45	T	G	7: 140,691,571	I222S	probably damaging	Het
Olfr586	T	A	7: 103,122,692	I27F	probably benign	Het
Otud6b	A	G	4: 14,826,414	C18R	probably benign	Het
Pde4d	A	G	13: 109,935,324	E284G	probably damaging	Het
Peg10	CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC	CATC	6: 4,756,431		probably benign	Het
Pidd1	C	A	7: 141,440,142	W598L	probably damaging	Het
Pira2	A	T	7: 3,844,544	C49S	probably damaging	Het
Pramef6	T	C	4: 143,897,718	M70V	possibly damaging	Het
Prdx1	T	G	4: 116,693,738	D135E	probably benign	Het
Rab15	T	A	12: 76,803,129	Y88F	probably damaging	Het
Rem2	C	A	14: 54,477,799	H144Q	probably damaging	Het
Sel1l3	T	C	5: 53,144,064	D737G	probably damaging	Het
Srd5a3	C	T	5: 76,147,819	Q119*	probably null	Het
Suclg2	G	T	6: 95,594,722	Q120K	probably benign	Het
Tacc2	T	A	7: 130,625,431	M1282K	probably benign	Het
Tbc1d5	T	A	17: 50,756,692	Q620L	probably damaging	Het
Tdrd3	G	T	14: 87,472,154	A91S	probably damaging	Het
Thsd7b	T	A	1: 130,159,698	F1184Y	probably benign	Het
Trim28	T	A	7: 13,028,412	V321E	possibly damaging	Het
Trim5	C	A	7: 104,266,468		probably null	Het
Ugt2b37	A	T	5: 87,242,440	Y382*	probably null	Het
Usp40	C	T	1: 87,982,130	G534D	probably damaging	Het
Usp53	A	T	3: 122,934,463	H823Q	probably benign	Het
Vmn2r12	T	A	5: 109,087,963	M508L	probably benign	Het
Vmn2r56	T	A	7: 12,715,424	I296F	probably benign	Het
Vps13a	T	C	19: 16,655,304	S2563G	probably damaging	Het
Wdr59	A	G	8: 111,494,280	F207L		Het
Zan	A	G	5: 137,407,033	S3777P	unknown	Het
Zfp277	T	C	12: 40,315,881	N530D	possibly damaging	Het
Zfp365	G	A	10: 67,909,919	R10W	probably damaging	Het
Zfp384	A	T	6: 125,036,325	H452L	probably damaging	Het
Zfyve28	A	T	5: 34,217,143	L509Q	probably damaging	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116234505	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116222584	nonsense	probably null
IGL00941:Evpl	APN	11	116227901	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116222454	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116233444	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116223222	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116227015	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116231024	nonsense	probably null
IGL02457:Evpl	APN	11	116230113	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116222718	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116221209	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116221822	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116221612	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116227927	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116220834	missense	probably damaging	1.00
PIT4449001:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116235003	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116220876	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116223291	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116229490	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116232485	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116230068	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116223835	missense	probably benign
R1699:Evpl	UTSW	11	116227588	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116225492	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116223660	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116227576	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116227028	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116234266	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116221839	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116237969	missense	unknown
R3081:Evpl	UTSW	11	116220852	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116223177	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116232644	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116222505	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116223375	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116222969	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116221365	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116234259	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116234232	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116234432	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116230922	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116230101	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116222814	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116237906	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116222944	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116223807	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116223113	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116223949	missense	probably benign
R7395:Evpl	UTSW	11	116227079	missense	possibly damaging	0.94
R7441:Evpl	UTSW	11	116222956	nonsense	probably null
R7505:Evpl	UTSW	11	116226987	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116222568	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116221435	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116234174	missense	not run
R7944:Evpl	UTSW	11	116228069	missense	probably damaging	1.00
R8008:Evpl	UTSW	11	116230472	missense	probably null	0.21
R8040:Evpl	UTSW	11	116222932	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116223163	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GACACAGACCACTCCTGTCTTC -3'
(R):5'- AAATCCCTGACGGTGTCCTC -3'

Sequencing Primer
(F):5'- TACCTGCAGCTCGCTGAC -3'
(R):5'- TGACGGTGTCCTCTGCCTG -3'

Posted On

2019-12-20