Incidental Mutation 'R7861:Dlg5'
ID 607539
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Name discs large MAGUK scaffold protein 5
Synonyms 4933429D20Rik
MMRRC Submission 045914-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7861 (G1)
Quality Score 191.009
Status Not validated
Chromosome 14
Chromosomal Location 24184021-24295988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24295280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 80 (P80L)
Ref Sequence ENSEMBL: ENSMUSP00000087879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073687] [ENSMUST00000090398]
AlphaFold E9Q9R9
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: P80L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: P80L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: P80L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: P80L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169880
SMART Domains Protein: ENSMUSP00000131986
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:Takusan 45 130 1.9e-34 PFAM
Meta Mutation Damage Score 0.3068 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,797,360 (GRCm39) I50F possibly damaging Het
Abcc3 T C 11: 94,248,075 (GRCm39) D1175G probably null Het
Accs C A 2: 93,666,077 (GRCm39) *503L probably null Het
Adgra2 A G 8: 27,604,485 (GRCm39) E520G probably damaging Het
Aldh7a1 C A 18: 56,681,525 (GRCm39) C215F probably benign Het
Apbb1ip A C 2: 22,706,990 (GRCm39) D9A unknown Het
Atad2 G A 15: 57,989,176 (GRCm39) A228V probably benign Het
Atp10a T C 7: 58,438,107 (GRCm39) S430P probably damaging Het
Atp1a3 T C 7: 24,700,573 (GRCm39) D6G unknown Het
Brca1 A T 11: 101,417,248 (GRCm39) N295K possibly damaging Het
Caly C A 7: 139,661,301 (GRCm39) probably benign Het
Ces1h A G 8: 94,084,053 (GRCm39) Y386H unknown Het
Col14a1 A G 15: 55,308,012 (GRCm39) D1044G unknown Het
Csf2rb A G 15: 78,233,357 (GRCm39) D888G probably damaging Het
Cux1 T C 5: 136,281,458 (GRCm39) E568G possibly damaging Het
Dhrs7b T A 11: 60,746,568 (GRCm39) L219Q probably damaging Het
Dnah14 C T 1: 181,444,324 (GRCm39) P545S probably damaging Het
Dnajc24 A T 2: 105,832,380 (GRCm39) M1K probably null Het
Dusp12 C T 1: 170,702,095 (GRCm39) W301* probably null Het
Dyrk1a G T 16: 94,492,575 (GRCm39) G603* probably null Het
Eif4g1 T A 16: 20,498,452 (GRCm39) V403E probably benign Het
Epn3 T C 11: 94,387,100 (GRCm39) E90G probably damaging Het
Etl4 A G 2: 20,810,721 (GRCm39) S1303G probably benign Het
Evpl A T 11: 116,118,895 (GRCm39) Y627N probably damaging Het
Fbxw25 A T 9: 109,493,625 (GRCm39) L22* probably null Het
Fcamr T A 1: 130,742,375 (GRCm39) N587K probably benign Het
Fgd6 A G 10: 93,939,193 (GRCm39) N946S probably benign Het
Fndc3b A T 3: 27,523,148 (GRCm39) I477N possibly damaging Het
Grifin C T 5: 140,550,280 (GRCm39) A54T probably benign Het
Gtf2b A G 3: 142,487,105 (GRCm39) I180M probably damaging Het
Invs A T 4: 48,397,559 (GRCm39) D378V possibly damaging Het
Itgb6 T C 2: 60,458,788 (GRCm39) E378G probably damaging Het
Khdc1a T C 1: 21,420,623 (GRCm39) I81T possibly damaging Het
Kif20b T A 19: 34,917,322 (GRCm39) D617E probably damaging Het
Kifc3 T A 8: 95,834,165 (GRCm39) probably null Het
Kirrel3 C T 9: 34,931,419 (GRCm39) H403Y possibly damaging Het
Klf15 G A 6: 90,443,820 (GRCm39) V132I probably benign Het
Kmt2a A G 9: 44,730,031 (GRCm39) S3429P unknown Het
Lama1 T G 17: 68,116,216 (GRCm39) L2361R Het
Lrp1b T C 2: 40,587,570 (GRCm39) D3895G Het
Mcoln3 A C 3: 145,830,546 (GRCm39) E92A possibly damaging Het
Myo3b T C 2: 69,939,032 (GRCm39) M135T probably damaging Het
Mysm1 A G 4: 94,835,204 (GRCm39) *820Q probably null Het
Ncoa7 A G 10: 30,567,056 (GRCm39) S541P probably benign Het
Nup54 T C 5: 92,578,952 (GRCm39) T33A unknown Het
Or10al2 C A 17: 37,983,408 (GRCm39) Q165K possibly damaging Het
Or13a17 T G 7: 140,271,484 (GRCm39) I222S probably damaging Het
Or1s2 T C 19: 13,758,810 (GRCm39) V276A possibly damaging Het
Or4k42 T A 2: 111,320,369 (GRCm39) I45F probably damaging Het
Or51a5 T A 7: 102,771,899 (GRCm39) I27F probably benign Het
Otud6b A G 4: 14,826,414 (GRCm39) C18R probably benign Het
Pde4d A G 13: 110,071,858 (GRCm39) E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Pidd1 C A 7: 141,020,055 (GRCm39) W598L probably damaging Het
Pira2 A T 7: 3,847,543 (GRCm39) C49S probably damaging Het
Pramel11 T C 4: 143,624,288 (GRCm39) M70V possibly damaging Het
Prdx1 T G 4: 116,550,935 (GRCm39) D135E probably benign Het
Rab15 T A 12: 76,849,903 (GRCm39) Y88F probably damaging Het
Rem2 C A 14: 54,715,256 (GRCm39) H144Q probably damaging Het
Sel1l3 T C 5: 53,301,406 (GRCm39) D737G probably damaging Het
Srd5a3 C T 5: 76,295,666 (GRCm39) Q119* probably null Het
Suclg2 G T 6: 95,571,703 (GRCm39) Q120K probably benign Het
Tacc2 T A 7: 130,227,161 (GRCm39) M1282K probably benign Het
Tbc1d5 T A 17: 51,063,720 (GRCm39) Q620L probably damaging Het
Tdrd3 G T 14: 87,709,590 (GRCm39) A91S probably damaging Het
Thsd7b T A 1: 130,087,435 (GRCm39) F1184Y probably benign Het
Trim28 T A 7: 12,762,339 (GRCm39) V321E possibly damaging Het
Trim5 C A 7: 103,915,675 (GRCm39) probably null Het
Ugt2b37 A T 5: 87,390,299 (GRCm39) Y382* probably null Het
Usp40 C T 1: 87,909,852 (GRCm39) G534D probably damaging Het
Usp53 A T 3: 122,728,112 (GRCm39) H823Q probably benign Het
Vmn2r12 T A 5: 109,235,829 (GRCm39) M508L probably benign Het
Vmn2r56 T A 7: 12,449,351 (GRCm39) I296F probably benign Het
Vps13a T C 19: 16,632,668 (GRCm39) S2563G probably damaging Het
Wdr59 A G 8: 112,220,912 (GRCm39) F207L Het
Zan A G 5: 137,405,295 (GRCm39) S3777P unknown Het
Zfp277 T C 12: 40,365,880 (GRCm39) N530D possibly damaging Het
Zfp365 G A 10: 67,745,749 (GRCm39) R10W probably damaging Het
Zfp384 A T 6: 125,013,288 (GRCm39) H452L probably damaging Het
Zftraf1 C T 15: 76,532,386 (GRCm39) D241N probably benign Het
Zfyve28 A T 5: 34,374,487 (GRCm39) L509Q probably damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24,241,229 (GRCm39) missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24,208,532 (GRCm39) missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24,215,353 (GRCm39) missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24,196,265 (GRCm39) missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24,252,419 (GRCm39) missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24,208,660 (GRCm39) missense probably benign
IGL01621:Dlg5 APN 14 24,198,289 (GRCm39) missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24,188,759 (GRCm39) missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24,220,517 (GRCm39) missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24,222,271 (GRCm39) missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24,194,414 (GRCm39) missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24,208,419 (GRCm39) missense probably benign
IGL02146:Dlg5 APN 14 24,252,429 (GRCm39) missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24,200,277 (GRCm39) missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24,216,275 (GRCm39) missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24,241,250 (GRCm39) missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24,196,319 (GRCm39) missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24,208,567 (GRCm39) missense probably benign 0.06
IGL02965:Dlg5 APN 14 24,222,091 (GRCm39) missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24,216,323 (GRCm39) missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24,220,522 (GRCm39) missense probably benign 0.03
legerdemain UTSW 14 24,214,615 (GRCm39) missense probably damaging 1.00
R0123:Dlg5 UTSW 14 24,197,274 (GRCm39) missense probably benign
R0131:Dlg5 UTSW 14 24,188,717 (GRCm39) missense probably damaging 1.00
R0709:Dlg5 UTSW 14 24,196,323 (GRCm39) missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24,226,465 (GRCm39) missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24,185,645 (GRCm39) missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24,185,645 (GRCm39) missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24,204,699 (GRCm39) missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24,226,676 (GRCm39) missense probably benign 0.06
R1402:Dlg5 UTSW 14 24,226,676 (GRCm39) missense probably benign 0.06
R1438:Dlg5 UTSW 14 24,204,673 (GRCm39) missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24,185,711 (GRCm39) missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24,204,764 (GRCm39) splice site probably null
R1465:Dlg5 UTSW 14 24,204,764 (GRCm39) splice site probably null
R1543:Dlg5 UTSW 14 24,194,516 (GRCm39) missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24,199,512 (GRCm39) missense probably benign 0.28
R1899:Dlg5 UTSW 14 24,198,368 (GRCm39) missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24,226,639 (GRCm39) missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24,226,639 (GRCm39) missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24,206,537 (GRCm39) splice site probably benign
R1968:Dlg5 UTSW 14 24,214,187 (GRCm39) nonsense probably null
R2049:Dlg5 UTSW 14 24,204,715 (GRCm39) missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24,186,703 (GRCm39) missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24,227,826 (GRCm39) nonsense probably null
R2139:Dlg5 UTSW 14 24,220,612 (GRCm39) missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24,187,225 (GRCm39) missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24,208,731 (GRCm39) missense probably benign 0.00
R2293:Dlg5 UTSW 14 24,208,180 (GRCm39) missense probably benign
R2356:Dlg5 UTSW 14 24,220,496 (GRCm39) critical splice donor site probably null
R2362:Dlg5 UTSW 14 24,208,755 (GRCm39) missense probably benign 0.04
R2513:Dlg5 UTSW 14 24,214,593 (GRCm39) missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24,216,258 (GRCm39) missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24,216,258 (GRCm39) missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24,215,328 (GRCm39) missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24,240,378 (GRCm39) unclassified probably benign
R3782:Dlg5 UTSW 14 24,240,378 (GRCm39) unclassified probably benign
R3828:Dlg5 UTSW 14 24,196,226 (GRCm39) missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24,198,328 (GRCm39) missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24,228,057 (GRCm39) critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24,208,236 (GRCm39) missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24,187,249 (GRCm39) missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24,228,051 (GRCm39) missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24,194,451 (GRCm39) missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24,204,757 (GRCm39) missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24,204,757 (GRCm39) missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24,204,429 (GRCm39) missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24,186,690 (GRCm39) missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24,186,690 (GRCm39) missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24,186,690 (GRCm39) missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24,242,930 (GRCm39) missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24,227,860 (GRCm39) missense probably benign 0.03
R5567:Dlg5 UTSW 14 24,242,981 (GRCm39) nonsense probably null
R5570:Dlg5 UTSW 14 24,242,981 (GRCm39) nonsense probably null
R5640:Dlg5 UTSW 14 24,220,529 (GRCm39) missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24,208,767 (GRCm39) missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24,200,716 (GRCm39) missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24,196,322 (GRCm39) missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24,199,515 (GRCm39) missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24,214,157 (GRCm39) missense probably benign
R6190:Dlg5 UTSW 14 24,240,506 (GRCm39) missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24,199,596 (GRCm39) splice site probably null
R6276:Dlg5 UTSW 14 24,214,636 (GRCm39) missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24,208,128 (GRCm39) missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24,188,774 (GRCm39) missense probably benign 0.45
R6527:Dlg5 UTSW 14 24,240,516 (GRCm39) missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24,200,720 (GRCm39) missense probably benign 0.01
R6687:Dlg5 UTSW 14 24,240,441 (GRCm39) missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24,199,498 (GRCm39) missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24,196,263 (GRCm39) missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24,227,865 (GRCm39) missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24,240,492 (GRCm39) missense probably benign 0.00
R7182:Dlg5 UTSW 14 24,294,924 (GRCm39) missense
R7203:Dlg5 UTSW 14 24,188,723 (GRCm39) missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24,186,706 (GRCm39) nonsense probably null
R7359:Dlg5 UTSW 14 24,214,615 (GRCm39) missense probably damaging 1.00
R7466:Dlg5 UTSW 14 24,295,280 (GRCm39) missense probably damaging 1.00
R7485:Dlg5 UTSW 14 24,227,907 (GRCm39) missense probably damaging 0.98
R7485:Dlg5 UTSW 14 24,198,390 (GRCm39) missense probably benign
R7629:Dlg5 UTSW 14 24,295,280 (GRCm39) missense probably damaging 1.00
R7666:Dlg5 UTSW 14 24,207,867 (GRCm39) missense probably damaging 1.00
R7804:Dlg5 UTSW 14 24,215,388 (GRCm39) missense possibly damaging 0.46
R7862:Dlg5 UTSW 14 24,295,280 (GRCm39) missense probably damaging 1.00
R7864:Dlg5 UTSW 14 24,295,280 (GRCm39) missense probably damaging 1.00
R7874:Dlg5 UTSW 14 24,185,687 (GRCm39) missense probably damaging 1.00
R7913:Dlg5 UTSW 14 24,187,192 (GRCm39) splice site probably null
R7981:Dlg5 UTSW 14 24,208,213 (GRCm39) missense probably benign
R8147:Dlg5 UTSW 14 24,208,395 (GRCm39) missense probably benign 0.07
R8204:Dlg5 UTSW 14 24,210,320 (GRCm39) missense probably damaging 1.00
R8206:Dlg5 UTSW 14 24,210,336 (GRCm39) missense possibly damaging 0.62
R8287:Dlg5 UTSW 14 24,214,453 (GRCm39) missense probably benign 0.40
R8296:Dlg5 UTSW 14 24,198,328 (GRCm39) missense possibly damaging 0.94
R8317:Dlg5 UTSW 14 24,241,298 (GRCm39) missense probably damaging 0.98
R8327:Dlg5 UTSW 14 24,196,388 (GRCm39) missense probably damaging 0.99
R8352:Dlg5 UTSW 14 24,241,261 (GRCm39) missense probably damaging 1.00
R8353:Dlg5 UTSW 14 24,208,213 (GRCm39) missense probably benign
R8409:Dlg5 UTSW 14 24,226,546 (GRCm39) missense probably damaging 1.00
R8452:Dlg5 UTSW 14 24,241,261 (GRCm39) missense probably damaging 1.00
R8453:Dlg5 UTSW 14 24,208,213 (GRCm39) missense probably benign
R8540:Dlg5 UTSW 14 24,208,767 (GRCm39) missense probably damaging 1.00
R8701:Dlg5 UTSW 14 24,226,768 (GRCm39) missense probably benign 0.04
R8925:Dlg5 UTSW 14 24,206,547 (GRCm39) missense
R8927:Dlg5 UTSW 14 24,206,547 (GRCm39) missense
R9025:Dlg5 UTSW 14 24,199,546 (GRCm39) missense probably benign 0.00
R9102:Dlg5 UTSW 14 24,199,567 (GRCm39) missense probably damaging 1.00
R9138:Dlg5 UTSW 14 24,295,376 (GRCm39) missense probably damaging 0.98
R9165:Dlg5 UTSW 14 24,196,309 (GRCm39) missense probably damaging 1.00
R9250:Dlg5 UTSW 14 24,240,543 (GRCm39) missense probably benign 0.07
R9267:Dlg5 UTSW 14 24,204,745 (GRCm39) missense probably damaging 1.00
R9269:Dlg5 UTSW 14 24,242,881 (GRCm39) missense probably damaging 0.99
R9291:Dlg5 UTSW 14 24,241,229 (GRCm39) missense probably damaging 0.99
R9387:Dlg5 UTSW 14 24,197,168 (GRCm39) missense probably damaging 0.99
R9729:Dlg5 UTSW 14 24,204,681 (GRCm39) missense probably benign 0.00
RF005:Dlg5 UTSW 14 24,208,561 (GRCm39) nonsense probably null
YA93:Dlg5 UTSW 14 24,205,201 (GRCm39) unclassified probably benign
Z1088:Dlg5 UTSW 14 24,208,162 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCCGGGTAGGATAAGAGAG -3'
(R):5'- TTGAGAGCTGCCCGATCGT -3'

Sequencing Primer
(F):5'- AGAGAAGGTGTCACCCGC -3'
(R):5'- AGTGTCAGCAGAGCCTGG -3'
Posted On 2019-12-20