Incidental Mutation 'R0196:Xrn2'
ID 60754
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name 5'-3' exoribonuclease 2
Synonyms
MMRRC Submission 038455-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R0196 (G1)
Quality Score 153
Status Not validated
Chromosome 2
Chromosomal Location 146854916-146919920 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146889580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 654 (D654E)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
AlphaFold Q9DBR1
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: D654E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: D654E

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136136
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,446,591 (GRCm39) probably benign Het
Aass G A 6: 23,109,519 (GRCm39) P317L probably damaging Het
Abca12 T A 1: 71,298,972 (GRCm39) N2313I possibly damaging Het
Adamts12 T C 15: 11,071,594 (GRCm39) I46T probably benign Het
Adipoq T G 16: 22,965,393 (GRCm39) probably null Het
Amy1 A T 3: 113,363,070 (GRCm39) D92E probably benign Het
Asb15 G A 6: 24,564,392 (GRCm39) R282Q probably damaging Het
Bag6 G C 17: 35,363,239 (GRCm39) G693A probably damaging Het
Birc6 T C 17: 74,887,282 (GRCm39) I870T possibly damaging Het
Cand2 A G 6: 115,766,463 (GRCm39) K356R probably damaging Het
Cbfa2t3 T C 8: 123,360,076 (GRCm39) Q525R possibly damaging Het
Cd4 T C 6: 124,844,769 (GRCm39) R339G probably damaging Het
Cdh8 A G 8: 99,917,066 (GRCm39) S350P probably damaging Het
Cep295 A T 9: 15,249,509 (GRCm39) S469T probably damaging Het
Ckap2l A T 2: 129,127,342 (GRCm39) S279T probably benign Het
Clnk T A 5: 38,927,282 (GRCm39) N66Y probably damaging Het
Col27a1 A T 4: 63,142,503 (GRCm39) T64S probably benign Het
Crtc1 T C 8: 70,838,871 (GRCm39) D599G probably damaging Het
Cyp2c23 A C 19: 44,000,795 (GRCm39) I363S probably damaging Het
Dnah10 A T 5: 124,911,139 (GRCm39) I4519F possibly damaging Het
Dner T A 1: 84,348,553 (GRCm39) I716F probably damaging Het
Dsel T G 1: 111,789,333 (GRCm39) T401P possibly damaging Het
Egfr A G 11: 16,861,746 (GRCm39) D1175G probably benign Het
Ephb3 A T 16: 21,036,804 (GRCm39) N343I probably damaging Het
Fbxw10 T A 11: 62,768,070 (GRCm39) F974I probably benign Het
Gfi1b T C 2: 28,503,786 (GRCm39) Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 (GRCm39) L6H probably benign Het
Grb10 A C 11: 11,895,583 (GRCm39) V247G probably damaging Het
Gstp2 A T 19: 4,090,514 (GRCm39) probably null Het
Hars2 C T 18: 36,922,257 (GRCm39) Q291* probably null Het
Hyal4 G T 6: 24,756,220 (GRCm39) W146L probably damaging Het
Il22ra1 C T 4: 135,461,556 (GRCm39) T107I possibly damaging Het
Itga8 A G 2: 12,209,540 (GRCm39) probably null Het
Klhl25 T C 7: 75,515,450 (GRCm39) S119P probably damaging Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lrrc8c T C 5: 105,754,636 (GRCm39) V137A probably benign Het
Macrod2 A T 2: 142,018,545 (GRCm39) E226V probably damaging Het
Mcemp1 A T 8: 3,718,201 (GRCm39) Q165L probably benign Het
Mcpt9 T A 14: 56,265,453 (GRCm39) K82M probably benign Het
Mpzl3 A G 9: 44,973,458 (GRCm39) T66A probably damaging Het
Msh6 G A 17: 88,287,788 (GRCm39) V143I possibly damaging Het
Mug1 G A 6: 121,815,684 (GRCm39) probably null Het
Ncr1 G T 7: 4,343,972 (GRCm39) C153F probably damaging Het
Nf1 T A 11: 79,359,595 (GRCm39) M1411K possibly damaging Het
Nf1 T A 11: 79,469,098 (GRCm39) V786D probably damaging Het
Nisch T C 14: 30,925,351 (GRCm39) probably benign Het
Nwd2 T A 5: 63,963,694 (GRCm39) Y1093N probably benign Het
Oas3 G A 5: 120,894,210 (GRCm39) R39C probably damaging Het
Or1e32 A T 11: 73,705,731 (GRCm39) M59K probably damaging Het
Or7a36 C T 10: 78,820,023 (GRCm39) T133I possibly damaging Het
Oxa1l T C 14: 54,600,944 (GRCm39) I139T probably damaging Het
P3h3 T A 6: 124,822,235 (GRCm39) N583Y probably damaging Het
Pcdh18 A T 3: 49,711,147 (GRCm39) probably null Het
Pcnp C T 16: 55,844,896 (GRCm39) probably benign Het
Pdzd8 G T 19: 59,289,563 (GRCm39) D612E probably benign Het
Pi4kb T C 3: 94,906,261 (GRCm39) S8P probably damaging Het
Pikfyve T G 1: 65,295,231 (GRCm39) V1454G possibly damaging Het
Podn T C 4: 107,878,695 (GRCm39) N246D probably damaging Het
Prg4 T C 1: 150,330,243 (GRCm39) probably benign Het
R3hdm2 T C 10: 127,320,390 (GRCm39) Y523H probably damaging Het
Rpf1 T A 3: 146,213,904 (GRCm39) E231V possibly damaging Het
Slc16a10 C T 10: 39,932,611 (GRCm39) E317K probably benign Het
Slc34a1 A T 13: 55,560,078 (GRCm39) I435F probably damaging Het
Snx19 A G 9: 30,344,683 (GRCm39) D629G probably damaging Het
Tomm70a T C 16: 56,966,463 (GRCm39) I472T probably benign Het
Trp53 A G 11: 69,479,506 (GRCm39) Y202C probably damaging Het
Ttc14 T A 3: 33,863,403 (GRCm39) probably benign Het
Ugt1a1 C T 1: 88,140,277 (GRCm39) A185V possibly damaging Het
Usp28 A G 9: 48,939,578 (GRCm39) D655G probably damaging Het
Vmn1r215 C T 13: 23,260,254 (GRCm39) T98I probably damaging Het
Vmn2r121 G T X: 123,041,879 (GRCm39) T426N probably benign Het
Vmn2r99 A G 17: 19,614,835 (GRCm39) N852D probably benign Het
Yju2 C A 17: 56,271,653 (GRCm39) D191E probably damaging Het
Zfp335 C G 2: 164,738,065 (GRCm39) A849P possibly damaging Het
Zfp954 C T 7: 7,118,390 (GRCm39) V385M probably damaging Het
Zmynd15 A G 11: 70,355,052 (GRCm39) T350A probably damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 146,878,670 (GRCm39) missense probably benign 0.00
IGL00950:Xrn2 APN 2 146,870,066 (GRCm39) nonsense probably null
IGL01323:Xrn2 APN 2 146,876,767 (GRCm39) splice site probably benign
IGL01328:Xrn2 APN 2 146,871,850 (GRCm39) missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 146,880,099 (GRCm39) missense probably benign
IGL01729:Xrn2 APN 2 146,878,717 (GRCm39) critical splice donor site probably null
IGL01805:Xrn2 APN 2 146,870,063 (GRCm39) missense probably damaging 0.98
IGL02326:Xrn2 APN 2 146,889,633 (GRCm39) missense probably benign 0.32
IGL02332:Xrn2 APN 2 146,868,510 (GRCm39) missense probably damaging 1.00
IGL02556:Xrn2 APN 2 146,880,216 (GRCm39) splice site probably benign
IGL02609:Xrn2 APN 2 146,891,945 (GRCm39) missense probably benign 0.00
IGL02941:Xrn2 APN 2 146,868,444 (GRCm39) missense probably damaging 1.00
IGL03119:Xrn2 APN 2 146,884,792 (GRCm39) missense probably damaging 1.00
R0052:Xrn2 UTSW 2 146,882,885 (GRCm39) splice site probably benign
R0114:Xrn2 UTSW 2 146,871,699 (GRCm39) missense probably damaging 0.98
R0799:Xrn2 UTSW 2 146,871,818 (GRCm39) missense probably benign 0.03
R0991:Xrn2 UTSW 2 146,884,002 (GRCm39) missense probably benign 0.40
R1444:Xrn2 UTSW 2 146,903,408 (GRCm39) missense probably damaging 0.99
R1727:Xrn2 UTSW 2 146,903,436 (GRCm39) missense probably benign 0.00
R1735:Xrn2 UTSW 2 146,903,343 (GRCm39) missense probably damaging 1.00
R1885:Xrn2 UTSW 2 146,891,281 (GRCm39) nonsense probably null
R2199:Xrn2 UTSW 2 146,866,670 (GRCm39) missense probably damaging 0.96
R2884:Xrn2 UTSW 2 146,889,576 (GRCm39) missense probably damaging 1.00
R3730:Xrn2 UTSW 2 146,866,729 (GRCm39) missense probably benign 0.09
R3771:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3772:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3773:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3816:Xrn2 UTSW 2 146,870,120 (GRCm39) missense probably damaging 1.00
R3927:Xrn2 UTSW 2 146,880,109 (GRCm39) missense probably benign
R4173:Xrn2 UTSW 2 146,889,612 (GRCm39) missense probably damaging 0.96
R4659:Xrn2 UTSW 2 146,903,394 (GRCm39) missense probably benign 0.01
R4928:Xrn2 UTSW 2 146,893,638 (GRCm39) missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 146,866,633 (GRCm39) critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 146,871,675 (GRCm39) missense probably benign 0.02
R6297:Xrn2 UTSW 2 146,868,490 (GRCm39) missense probably damaging 1.00
R6301:Xrn2 UTSW 2 146,905,262 (GRCm39) missense probably benign 0.05
R6316:Xrn2 UTSW 2 146,883,930 (GRCm39) missense probably damaging 1.00
R6705:Xrn2 UTSW 2 146,878,582 (GRCm39) critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 146,884,013 (GRCm39) missense probably damaging 1.00
R7408:Xrn2 UTSW 2 146,884,017 (GRCm39) critical splice donor site probably null
R7412:Xrn2 UTSW 2 146,891,266 (GRCm39) missense probably damaging 0.99
R7501:Xrn2 UTSW 2 146,871,676 (GRCm39) missense probably damaging 1.00
R7856:Xrn2 UTSW 2 146,910,393 (GRCm39) splice site probably null
R8912:Xrn2 UTSW 2 146,891,913 (GRCm39) missense probably benign 0.04
R8969:Xrn2 UTSW 2 146,871,304 (GRCm39) missense probably damaging 1.00
R9083:Xrn2 UTSW 2 146,880,199 (GRCm39) missense probably damaging 1.00
R9179:Xrn2 UTSW 2 146,855,081 (GRCm39) missense probably benign 0.04
Z1177:Xrn2 UTSW 2 146,870,126 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGTTGGCCTGAGGGCATTAGTAAGG -3'
(R):5'- tgccaccaaagcccagATGAACTG -3'

Sequencing Primer
(F):5'- CATTAGTAAGGTGATAGCACTGC -3'
(R):5'- ccaaagcccagATGAACTGTTAATC -3'
Posted On 2013-07-24