Incidental Mutation 'R7861:Aldh7a1'
ID607551
Institutional Source Beutler Lab
Gene Symbol Aldh7a1
Ensembl Gene ENSMUSG00000053644
Gene Namealdehyde dehydrogenase family 7, member A1
SynonymsD18Wsu181e, Atq1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7861 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location56509687-56572951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56548453 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 215 (C215F)
Ref Sequence ENSEMBL: ENSMUSP00000065089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066208] [ENSMUST00000171844] [ENSMUST00000172734] [ENSMUST00000174518] [ENSMUST00000174704]
Predicted Effect probably benign
Transcript: ENSMUST00000066208
AA Change: C215F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000065089
Gene: ENSMUSG00000053644
AA Change: C215F

DomainStartEndE-ValueType
Pfam:Aldedh 59 522 1.2e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170309
SMART Domains Protein: ENSMUSP00000127625
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 60 155 7.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171844
SMART Domains Protein: ENSMUSP00000127652
Gene: ENSMUSG00000053644

DomainStartEndE-ValueType
Pfam:Aldedh 47 121 1.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172734
AA Change: C215F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000134192
Gene: ENSMUSG00000053644
AA Change: C215F

DomainStartEndE-ValueType
Pfam:Aldedh 59 340 6.3e-74 PFAM
Pfam:Aldedh 338 458 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174518
AA Change: C187F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000133372
Gene: ENSMUSG00000053644
AA Change: C187F

DomainStartEndE-ValueType
Pfam:Aldedh 31 494 7.3e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174704
AA Change: C213F

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133970
Gene: ENSMUSG00000053644
AA Change: C213F

DomainStartEndE-ValueType
Pfam:Aldedh 57 293 1.4e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T A 5: 103,649,494 I50F possibly damaging Het
Abcc3 T C 11: 94,357,249 D1175G probably null Het
Accs C A 2: 93,835,732 *503L probably null Het
Adgra2 A G 8: 27,114,457 E520G probably damaging Het
Apbb1ip A C 2: 22,816,978 D9A unknown Het
Atad2 G A 15: 58,125,780 A228V probably benign Het
Atp10a T C 7: 58,788,359 S430P probably damaging Het
Atp1a3 T C 7: 25,001,148 D6G unknown Het
Brca1 A T 11: 101,526,422 N295K possibly damaging Het
Caly C A 7: 140,081,388 probably benign Het
Ces1h A G 8: 93,357,425 Y386H unknown Het
Col14a1 A G 15: 55,444,616 D1044G unknown Het
Csf2rb A G 15: 78,349,157 D888G probably damaging Het
Cux1 T C 5: 136,252,604 E568G possibly damaging Het
Cyhr1 C T 15: 76,648,186 D241N probably benign Het
Dhrs7b T A 11: 60,855,742 L219Q probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dnah14 C T 1: 181,616,759 P545S probably damaging Het
Dnajc24 A T 2: 106,002,035 M1K probably null Het
Dusp12 C T 1: 170,874,526 W301* probably null Het
Dyrk1a G T 16: 94,691,716 G603* probably null Het
Eif4g1 T A 16: 20,679,702 V403E probably benign Het
Epn3 T C 11: 94,496,274 E90G probably damaging Het
Etl4 A G 2: 20,805,910 S1303G probably benign Het
Evpl A T 11: 116,228,069 Y627N probably damaging Het
Fbxw25 A T 9: 109,664,557 L22* probably null Het
Fcamr T A 1: 130,814,638 N587K probably benign Het
Fgd6 A G 10: 94,103,331 N946S probably benign Het
Fndc3b A T 3: 27,468,999 I477N possibly damaging Het
Grifin C T 5: 140,564,525 A54T probably benign Het
Gtf2b A G 3: 142,781,344 I180M probably damaging Het
Invs A T 4: 48,397,559 D378V possibly damaging Het
Itgb6 T C 2: 60,628,444 E378G probably damaging Het
Khdc1a T C 1: 21,350,399 I81T possibly damaging Het
Kif20b T A 19: 34,939,922 D617E probably damaging Het
Kifc3 T A 8: 95,107,537 probably null Het
Kirrel3 C T 9: 35,020,123 H403Y possibly damaging Het
Klf15 G A 6: 90,466,838 V132I probably benign Het
Kmt2a A G 9: 44,818,734 S3429P unknown Het
Lama1 T G 17: 67,809,221 L2361R Het
Lrp1b T C 2: 40,697,558 D3895G Het
Mcoln3 A C 3: 146,124,791 E92A possibly damaging Het
Myo3b T C 2: 70,108,688 M135T probably damaging Het
Mysm1 A G 4: 94,946,967 *820Q probably null Het
Ncoa7 A G 10: 30,691,060 S541P probably benign Het
Nup54 T C 5: 92,431,093 T33A unknown Het
Olfr118 C A 17: 37,672,517 Q165K possibly damaging Het
Olfr1290 T A 2: 111,490,024 I45F probably damaging Het
Olfr1496 T C 19: 13,781,446 V276A possibly damaging Het
Olfr45 T G 7: 140,691,571 I222S probably damaging Het
Olfr586 T A 7: 103,122,692 I27F probably benign Het
Otud6b A G 4: 14,826,414 C18R probably benign Het
Pde4d A G 13: 109,935,324 E284G probably damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pidd1 C A 7: 141,440,142 W598L probably damaging Het
Pira2 A T 7: 3,844,544 C49S probably damaging Het
Pramef6 T C 4: 143,897,718 M70V possibly damaging Het
Prdx1 T G 4: 116,693,738 D135E probably benign Het
Rab15 T A 12: 76,803,129 Y88F probably damaging Het
Rem2 C A 14: 54,477,799 H144Q probably damaging Het
Sel1l3 T C 5: 53,144,064 D737G probably damaging Het
Srd5a3 C T 5: 76,147,819 Q119* probably null Het
Suclg2 G T 6: 95,594,722 Q120K probably benign Het
Tacc2 T A 7: 130,625,431 M1282K probably benign Het
Tbc1d5 T A 17: 50,756,692 Q620L probably damaging Het
Tdrd3 G T 14: 87,472,154 A91S probably damaging Het
Thsd7b T A 1: 130,159,698 F1184Y probably benign Het
Trim28 T A 7: 13,028,412 V321E possibly damaging Het
Trim5 C A 7: 104,266,468 probably null Het
Ugt2b37 A T 5: 87,242,440 Y382* probably null Het
Usp40 C T 1: 87,982,130 G534D probably damaging Het
Usp53 A T 3: 122,934,463 H823Q probably benign Het
Vmn2r12 T A 5: 109,087,963 M508L probably benign Het
Vmn2r56 T A 7: 12,715,424 I296F probably benign Het
Vps13a T C 19: 16,655,304 S2563G probably damaging Het
Wdr59 A G 8: 111,494,280 F207L Het
Zan A G 5: 137,407,033 S3777P unknown Het
Zfp277 T C 12: 40,315,881 N530D possibly damaging Het
Zfp365 G A 10: 67,909,919 R10W probably damaging Het
Zfp384 A T 6: 125,036,325 H452L probably damaging Het
Zfyve28 A T 5: 34,217,143 L509Q probably damaging Het
Other mutations in Aldh7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02690:Aldh7a1 APN 18 56528355 splice site probably benign
IGL02887:Aldh7a1 APN 18 56542216 intron probably benign
R0462:Aldh7a1 UTSW 18 56534214 unclassified probably null
R0595:Aldh7a1 UTSW 18 56546893 splice site probably benign
R0657:Aldh7a1 UTSW 18 56537197 splice site probably benign
R0947:Aldh7a1 UTSW 18 56560838 splice site probably null
R1295:Aldh7a1 UTSW 18 56546950 critical splice acceptor site probably null
R1385:Aldh7a1 UTSW 18 56542285 missense probably damaging 1.00
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1403:Aldh7a1 UTSW 18 56559269 nonsense probably null
R1517:Aldh7a1 UTSW 18 56532061 missense probably damaging 0.99
R1550:Aldh7a1 UTSW 18 56550382 missense possibly damaging 0.49
R3552:Aldh7a1 UTSW 18 56550292 splice site probably null
R3953:Aldh7a1 UTSW 18 56548505 missense probably damaging 0.99
R4124:Aldh7a1 UTSW 18 56537323 intron probably benign
R4296:Aldh7a1 UTSW 18 56544963 critical splice donor site probably null
R4355:Aldh7a1 UTSW 18 56548494 missense probably null 0.09
R4549:Aldh7a1 UTSW 18 56531994 missense probably benign 0.09
R4851:Aldh7a1 UTSW 18 56532016 missense possibly damaging 0.95
R5288:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5384:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5385:Aldh7a1 UTSW 18 56534253 missense possibly damaging 0.85
R5547:Aldh7a1 UTSW 18 56528284 missense probably damaging 1.00
R6505:Aldh7a1 UTSW 18 56526996 missense probably damaging 1.00
R7373:Aldh7a1 UTSW 18 56542317 missense possibly damaging 0.48
R7944:Aldh7a1 UTSW 18 56548453 missense probably benign 0.03
Z1177:Aldh7a1 UTSW 18 56526991 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGCTGCCAATGGTCAAG -3'
(R):5'- ACCACTAGGAATACACTTTGGTC -3'

Sequencing Primer
(F):5'- GGTCAAGTCCAAATTAAAATCAAACG -3'
(R):5'- TACTTTTGGTCAGAAGAGAAGTGGC -3'
Posted On2019-12-20