Incidental Mutation 'R7862:D1Pas1'
ID607558
Institutional Source Beutler Lab
Gene Symbol D1Pas1
Ensembl Gene ENSMUSG00000039224
Gene NameDNA segment, Chr 1, Pasteur Institute 1
SynonymsPl10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location186967416-186970627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 186968152 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 93 (G93R)
Ref Sequence ENSEMBL: ENSMUSP00000035261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045108]
Predicted Effect probably damaging
Transcript: ENSMUST00000045108
AA Change: G93R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035261
Gene: ENSMUSG00000039224
AA Change: G93R

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 80 102 N/A INTRINSIC
low complexity region 104 122 N/A INTRINSIC
DEXDc 198 417 9.08e-66 SMART
HELICc 454 535 1.23e-35 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 598 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abcc10 G T 17: 46,315,532 S661* probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Iqgap1 C T 7: 80,743,888 R647H probably benign Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Olfr918 C T 9: 38,673,328 V39M probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Spta1 G A 1: 174,197,785 probably null Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Thpo C T 16: 20,728,790 V24I probably benign Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in D1Pas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:D1Pas1 APN 1 186969412 missense possibly damaging 0.55
IGL00921:D1Pas1 APN 1 186968786 missense probably benign 0.44
R1693:D1Pas1 UTSW 1 186968029 missense probably benign
R2029:D1Pas1 UTSW 1 186968089 missense possibly damaging 0.53
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3733:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3930:D1Pas1 UTSW 1 186968280 missense probably damaging 1.00
R5302:D1Pas1 UTSW 1 186969445 missense probably damaging 1.00
R5815:D1Pas1 UTSW 1 186968009 missense probably damaging 1.00
R6705:D1Pas1 UTSW 1 186968379 missense probably benign 0.00
R7023:D1Pas1 UTSW 1 186968008 missense probably damaging 0.96
R7747:D1Pas1 UTSW 1 186968677 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCAGGGATGAGTCATGTGGC -3'
(R):5'- AAAGAGTTCCTGTTCCAAGCG -3'

Sequencing Primer
(F):5'- TTGGCTGGCCTAGACCTGAC -3'
(R):5'- GTTCCTGTTCCAAGCGTTCGC -3'
Posted On2019-12-20