Incidental Mutation 'R7862:Abtb2'
ID 607562
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 045915-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7862 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103532626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 475 (R475W)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably damaging
Transcript: ENSMUST00000076212
AA Change: R475W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: R475W

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,649,624 (GRCm39) *181S probably null Het
Abcc10 G T 17: 46,626,458 (GRCm39) S661* probably null Het
Cep97 T C 16: 55,726,084 (GRCm39) D673G probably benign Het
Chaf1b T C 16: 93,684,983 (GRCm39) M144T possibly damaging Het
Chd8 T C 14: 52,451,734 (GRCm39) D1372G probably damaging Het
Chmp6 G A 11: 119,807,836 (GRCm39) probably null Het
Cst12 T C 2: 148,631,495 (GRCm39) V72A probably damaging Het
D1Pas1 G A 1: 186,700,349 (GRCm39) G93R probably damaging Het
Dhx34 C A 7: 15,944,448 (GRCm39) V589F probably damaging Het
Dlg5 G A 14: 24,295,280 (GRCm39) P80L probably damaging Het
Dmrta1 C A 4: 89,576,561 (GRCm39) H6N probably benign Het
Dop1b T C 16: 93,546,851 (GRCm39) L285P probably damaging Het
Dpy19l1 T C 9: 24,386,730 (GRCm39) Y188C probably damaging Het
Ehbp1l1 C T 19: 5,770,851 (GRCm39) R230Q probably benign Het
Ep300 T G 15: 81,534,954 (GRCm39) V2337G probably damaging Het
Fh1 A T 1: 175,442,400 (GRCm39) V150E probably damaging Het
Fkbp11 G A 15: 98,624,389 (GRCm39) R122* probably null Het
Fkbp5 C T 17: 28,631,013 (GRCm39) E251K probably damaging Het
Fmnl1 A G 11: 103,071,756 (GRCm39) K88E probably damaging Het
Frrs1 T C 3: 116,685,529 (GRCm39) V300A possibly damaging Het
Glud1 T G 14: 34,047,479 (GRCm39) L198V possibly damaging Het
Gsdmc A T 15: 63,649,845 (GRCm39) W349R possibly damaging Het
Hacd1 T C 2: 14,050,013 (GRCm39) H64R probably damaging Het
Haus2 T A 2: 120,443,570 (GRCm39) D75E probably benign Het
Hmcn1 A T 1: 150,682,172 (GRCm39) F459L probably damaging Het
Ighe A T 12: 113,235,428 (GRCm39) V272E Het
Iqgap1 C T 7: 80,393,636 (GRCm39) R647H probably benign Het
Jmy T C 13: 93,635,703 (GRCm39) I38V possibly damaging Het
Kcnh1 G T 1: 191,873,167 (GRCm39) probably benign Het
Kctd20 C T 17: 29,181,849 (GRCm39) A167V probably damaging Het
Klhl38 A T 15: 58,178,395 (GRCm39) V525E probably damaging Het
Krit1 A G 5: 3,862,788 (GRCm39) D259G probably damaging Het
Med1 A T 11: 98,052,036 (GRCm39) C443S probably benign Het
Mllt6 T C 11: 97,556,631 (GRCm39) V107A probably benign Het
Myl7 A G 11: 5,847,157 (GRCm39) M132T probably benign Het
Myo10 T C 15: 25,666,522 (GRCm39) V11A probably damaging Het
Nipbl T C 15: 8,355,236 (GRCm39) I1642V probably benign Het
Or4a47 T C 2: 89,665,468 (GRCm39) T274A probably benign Het
Or6c214 T C 10: 129,591,224 (GRCm39) T32A probably benign Het
Or7g25 C A 9: 19,160,736 (GRCm39) probably benign Het
Or8b3b C T 9: 38,584,624 (GRCm39) V39M probably benign Het
Pcdhb2 C T 18: 37,429,113 (GRCm39) A362V probably benign Het
Pnp2 A T 14: 51,201,016 (GRCm39) D167V possibly damaging Het
Rasa1 G A 13: 85,403,530 (GRCm39) T282I probably damaging Het
Rp1l1 A G 14: 64,265,476 (GRCm39) D354G probably damaging Het
Rpap1 C T 2: 119,605,893 (GRCm39) probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Shank3 A G 15: 89,389,648 (GRCm39) D415G possibly damaging Het
Slc12a1 A G 2: 125,003,014 (GRCm39) I182V probably damaging Het
Slc6a13 A G 6: 121,312,589 (GRCm39) Y441C probably damaging Het
Sltm G T 9: 70,479,446 (GRCm39) E193* probably null Het
Spag9 T C 11: 94,002,892 (GRCm39) I1134T possibly damaging Het
Spta1 G A 1: 174,025,351 (GRCm39) probably null Het
Stk3 A G 15: 35,115,732 (GRCm39) V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 (GRCm39) I365F probably damaging Het
Thpo C T 16: 20,547,540 (GRCm39) V24I probably benign Het
Tle1 A C 4: 72,117,552 (GRCm39) L36R probably damaging Het
Togaram2 T C 17: 71,996,168 (GRCm39) V57A probably benign Het
Ttll9 C T 2: 152,848,895 (GRCm39) A459V probably benign Het
Ush1c T C 7: 45,870,848 (GRCm39) I330V probably damaging Het
Usp34 T C 11: 23,414,718 (GRCm39) M2906T Het
Vmn2r28 A T 7: 5,493,613 (GRCm39) M111K probably benign Het
Vmn2r97 T C 17: 19,167,416 (GRCm39) C557R probably damaging Het
Zfp873 T A 10: 81,896,109 (GRCm39) I280K probably benign Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGGCAGAGGTTCTCCAC -3'
(R):5'- TATGCCTGGCCTAGAAGAGTC -3'

Sequencing Primer
(F):5'- AGTCTGTAAAGGGCCGCATC -3'
(R):5'- AGTCCGCAGAAGGTACCTG -3'
Posted On 2019-12-20