Incidental Mutation 'R7862:Iqgap1'
ID607578
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80743888 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 647 (R647H)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: R647H

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: R647H

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abcc10 G T 17: 46,315,532 S661* probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
D1Pas1 G A 1: 186,968,152 G93R probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Olfr918 C T 9: 38,673,328 V39M probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Spta1 G A 1: 174,197,785 probably null Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Thpo C T 16: 20,728,790 V24I probably benign Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGCGTATCTTGGCCTAC -3'
(R):5'- GCCCAGAGGTGTAAGTATCCATG -3'

Sequencing Primer
(F):5'- ACATCTGTCTCCTGATATGCTCAAGG -3'
(R):5'- CAGAGGTGTAAGTATCCATGTGTCTG -3'
Posted On2019-12-20