Incidental Mutation 'R7862:Olfr918'
ID607582
Institutional Source Beutler Lab
Gene Symbol Olfr918
Ensembl Gene ENSMUSG00000046150
Gene Nameolfactory receptor 918
SynonymsGA_x6K02T2PVTD-32375756-32374818, MOR164-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38669861-38674601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38673328 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000150182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055099] [ENSMUST00000215461]
Predicted Effect probably benign
Transcript: ENSMUST00000055099
AA Change: V52M

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057210
Gene: ENSMUSG00000046150
AA Change: V52M

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:7tm_4 44 319 6.5e-48 PFAM
Pfam:7tm_1 54 301 3.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215461
AA Change: V39M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abcc10 G T 17: 46,315,532 S661* probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
D1Pas1 G A 1: 186,968,152 G93R probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Iqgap1 C T 7: 80,743,888 R647H probably benign Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Spta1 G A 1: 174,197,785 probably null Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Thpo C T 16: 20,728,790 V24I probably benign Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in Olfr918
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr918 APN 9 38673024 missense probably benign 0.01
IGL01388:Olfr918 APN 9 38673083 nonsense probably null
IGL01516:Olfr918 APN 9 38672863 missense probably benign 0.09
IGL02121:Olfr918 APN 9 38673415 missense probably damaging 0.98
IGL02209:Olfr918 APN 9 38673046 missense possibly damaging 0.84
IGL02256:Olfr918 APN 9 38673480 start codon destroyed probably null
IGL02517:Olfr918 APN 9 38672913 missense probably damaging 1.00
IGL02648:Olfr918 APN 9 38673016 missense probably benign
IGL02747:Olfr918 APN 9 38673084 missense probably benign 0.11
IGL02971:Olfr918 APN 9 38673268 missense probably damaging 0.96
E0370:Olfr918 UTSW 9 38672561 missense probably damaging 0.99
R0616:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R2173:Olfr918 UTSW 9 38672944 missense probably benign 0.03
R2989:Olfr918 UTSW 9 38672535 missense probably benign
R3430:Olfr918 UTSW 9 38673139 missense probably damaging 1.00
R3809:Olfr918 UTSW 9 38672863 missense probably benign 0.09
R4688:Olfr918 UTSW 9 38673363 missense probably damaging 1.00
R4702:Olfr918 UTSW 9 38673480 start codon destroyed probably null
R5548:Olfr918 UTSW 9 38673304 missense probably benign 0.00
R5590:Olfr918 UTSW 9 38672965 missense probably damaging 1.00
R6082:Olfr918 UTSW 9 38672570 missense probably damaging 1.00
R6214:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6215:Olfr918 UTSW 9 38673214 missense probably benign 0.13
R6893:Olfr918 UTSW 9 38673059 missense possibly damaging 0.95
R7215:Olfr918 UTSW 9 38673447 missense probably benign 0.05
R7624:Olfr918 UTSW 9 38672623 missense probably benign 0.18
R8116:Olfr918 UTSW 9 38673168 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AATAGCTGAGTCATGCACCC -3'
(R):5'- TTTGGTCCCGTTGTCATGAAC -3'

Sequencing Primer
(F):5'- ACCCCTCATAGGAGATGGAATTCTTC -3'
(R):5'- TTAGAAACAGATCACAAAGACATCGG -3'
Posted On2019-12-20