Mutagenetix > Incidental Mutation

Incidental Mutation 'R7862:Ep300'

607606

Institutional Source

Beutler Lab

Gene Symbol

Ep300

Ensembl Gene

ENSMUSG00000055024

Gene Name

E1A binding protein p300

Synonyms

KAT3B, p300

MMRRC Submission

045915-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7862 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81585351-81652077 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 81650753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 2337 (V2337G)

Ref Sequence

ENSEMBL: ENSMUSP00000066789 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068387]

AlphaFold

B2RWS6

Predicted Effect

probably damaging
Transcript: ENSMUST00000068387
AA Change: V2337G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000066789
Gene: ENSMUSG00000055024
AA Change: V2337G

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
low complexity region	162	178	N/A	INTRINSIC
low complexity region	223	242	N/A	INTRINSIC
low complexity region	296	309	N/A	INTRINSIC
ZnF_TAZ	333	418	2.85e-32	SMART
low complexity region	475	488	N/A	INTRINSIC
low complexity region	492	503	N/A	INTRINSIC
Pfam:KIX	567	647	7.2e-44	PFAM
low complexity region	722	735	N/A	INTRINSIC
low complexity region	831	848	N/A	INTRINSIC
low complexity region	852	882	N/A	INTRINSIC
low complexity region	884	920	N/A	INTRINSIC
low complexity region	924	943	N/A	INTRINSIC
low complexity region	1024	1039	N/A	INTRINSIC
BROMO	1047	1157	6.36e-42	SMART
Blast:KAT11	1227	1300	9e-22	BLAST
KAT11	1305	1610	1.19e-140	SMART
ZnF_ZZ	1663	1704	2.67e-15	SMART
ZnF_TAZ	1728	1806	5.53e-30	SMART
low complexity region	1810	1836	N/A	INTRINSIC
low complexity region	1847	1881	N/A	INTRINSIC
low complexity region	1902	1927	N/A	INTRINSIC
low complexity region	1962	1979	N/A	INTRINSIC
Pfam:Creb_binding	1993	2099	3.5e-37	PFAM
low complexity region	2146	2158	N/A	INTRINSIC
low complexity region	2187	2203	N/A	INTRINSIC
low complexity region	2205	2244	N/A	INTRINSIC
low complexity region	2254	2265	N/A	INTRINSIC
low complexity region	2303	2346	N/A	INTRINSIC
low complexity region	2390	2405	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the adenovirus E1A-associated cellular p300 transcriptional co-activator protein. It functions as histone acetyltransferase that regulates transcription via chromatin remodeling and is important in the processes of cell proliferation and differentiation. It mediates cAMP-gene regulation by binding specifically to phosphorylated CREB protein. This gene has also been identified as a co-activator of HIF1A (hypoxia-inducible factor 1 alpha), and thus plays a role in the stimulation of hypoxia-induced genes such as VEGF. Defects in this gene are a cause of Rubinstein-Taybi syndrome and may also play a role in epithelial cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lung, and small intestine and die at midgestation; heterozygotes also show some embryonic loss. Heterozygotes for an acetyltransferase-negative mutation die by the neonatal period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	A	C	3: 145,943,869	*181S	probably null	Het
Abcc10	G	T	17: 46,315,532	S661*	probably null	Het
Abtb2	C	T	2: 103,702,281	R475W	probably damaging	Het
Cep97	T	C	16: 55,905,721	D673G	probably benign	Het
Chaf1b	T	C	16: 93,888,095	M144T	possibly damaging	Het
Chd8	T	C	14: 52,214,277	D1372G	probably damaging	Het
Chmp6	G	A	11: 119,917,010		probably null	Het
Cst12	T	C	2: 148,789,575	V72A	probably damaging	Het
D1Pas1	G	A	1: 186,968,152	G93R	probably damaging	Het
Dhx34	C	A	7: 16,210,523	V589F	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmrta1	C	A	4: 89,688,324	H6N	probably benign	Het
Dopey2	T	C	16: 93,749,963	L285P	probably damaging	Het
Dpy19l1	T	C	9: 24,475,434	Y188C	probably damaging	Het
Ehbp1l1	C	T	19: 5,720,823	R230Q	probably benign	Het
Fh1	A	T	1: 175,614,834	V150E	probably damaging	Het
Fkbp11	G	A	15: 98,726,508	R122*	probably null	Het
Fkbp5	C	T	17: 28,412,039	E251K	probably damaging	Het
Fmnl1	A	G	11: 103,180,930	K88E	probably damaging	Het
Frrs1	T	C	3: 116,891,880	V300A	possibly damaging	Het
Glud1	T	G	14: 34,325,522	L198V	possibly damaging	Het
Gsdmc	A	T	15: 63,777,996	W349R	possibly damaging	Het
Hacd1	T	C	2: 14,045,202	H64R	probably damaging	Het
Haus2	T	A	2: 120,613,089	D75E	probably benign	Het
Hmcn1	A	T	1: 150,806,421	F459L	probably damaging	Het
Ighe	A	T	12: 113,271,808	V272E		Het
Iqgap1	C	T	7: 80,743,888	R647H	probably benign	Het
Jmy	T	C	13: 93,499,195	I38V	possibly damaging	Het
Kcnh1	G	T	1: 192,190,859		probably benign	Het
Kctd20	C	T	17: 28,962,875	A167V	probably damaging	Het
Klhl38	A	T	15: 58,314,999	V525E	probably damaging	Het
Krit1	A	G	5: 3,812,788	D259G	probably damaging	Het
Med1	A	T	11: 98,161,210	C443S	probably benign	Het
Mllt6	T	C	11: 97,665,805	V107A	probably benign	Het
Myl7	A	G	11: 5,897,157	M132T	probably benign	Het
Myo10	T	C	15: 25,666,436	V11A	probably damaging	Het
Nipbl	T	C	15: 8,325,752	I1642V	probably benign	Het
Olfr1256	T	C	2: 89,835,124	T274A	probably benign	Het
Olfr807	T	C	10: 129,755,355	T32A	probably benign	Het
Olfr843	C	A	9: 19,249,440		probably benign	Het
Olfr918	C	T	9: 38,673,328	V39M	probably benign	Het
Pcdhb2	C	T	18: 37,296,060	A362V	probably benign	Het
Pnp2	A	T	14: 50,963,559	D167V	possibly damaging	Het
Rasa1	G	A	13: 85,255,411	T282I	probably damaging	Het
Rp1l1	A	G	14: 64,028,027	D354G	probably damaging	Het
Rpap1	C	T	2: 119,775,412		probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Shank3	A	G	15: 89,505,445	D415G	possibly damaging	Het
Slc12a1	A	G	2: 125,161,094	I182V	probably damaging	Het
Slc6a13	A	G	6: 121,335,630	Y441C	probably damaging	Het
Sltm	G	T	9: 70,572,164	E193*	probably null	Het
Spag9	T	C	11: 94,112,066	I1134T	possibly damaging	Het
Spta1	G	A	1: 174,197,785		probably null	Het
Stk3	A	G	15: 35,115,586	V29A	possibly damaging	Het
Tgfbr1	A	T	4: 47,403,489	I365F	probably damaging	Het
Thpo	C	T	16: 20,728,790	V24I	probably benign	Het
Tle1	A	C	4: 72,199,315	L36R	probably damaging	Het
Togaram2	T	C	17: 71,689,173	V57A	probably benign	Het
Ttll9	C	T	2: 153,006,975	A459V	probably benign	Het
Ush1c	T	C	7: 46,221,424	I330V	probably damaging	Het
Usp34	T	C	11: 23,464,718	M2906T		Het
Vmn2r28	A	T	7: 5,490,614	M111K	probably benign	Het
Vmn2r97	T	C	17: 18,947,154	C557R	probably damaging	Het
Zfp873	T	A	10: 82,060,275	I280K	probably benign	Het

Other mutations in Ep300

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Ep300	APN	15	81641418	missense	unknown
IGL01128:Ep300	APN	15	81630006	unclassified	probably benign
IGL01151:Ep300	APN	15	81623472	intron	probably benign
IGL01414:Ep300	APN	15	81627266	unclassified	probably benign
IGL01564:Ep300	APN	15	81632464	unclassified	probably benign
IGL01875:Ep300	APN	15	81640023	missense	unknown
IGL01945:Ep300	APN	15	81616109	unclassified	probably benign
IGL02022:Ep300	APN	15	81611437	unclassified	probably benign
IGL02115:Ep300	APN	15	81648818	missense	unknown
IGL02129:Ep300	APN	15	81586636	missense	unknown
IGL02145:Ep300	APN	15	81601166	missense	unknown
IGL02149:Ep300	APN	15	81628420	unclassified	probably benign
IGL02165:Ep300	APN	15	81641391	missense	probably benign	0.39
IGL02226:Ep300	APN	15	81613412	missense	unknown
IGL02610:Ep300	APN	15	81601522	missense	unknown
IGL02731:Ep300	APN	15	81648414	missense	unknown
IGL03239:Ep300	APN	15	81641388	missense	unknown
BB001:Ep300	UTSW	15	81649502	missense	unknown
BB011:Ep300	UTSW	15	81649502	missense	unknown
R0077:Ep300	UTSW	15	81641313	missense	unknown
R0145:Ep300	UTSW	15	81616127	critical splice donor site	probably null
R0244:Ep300	UTSW	15	81640128	missense	unknown
R0390:Ep300	UTSW	15	81640116	missense	unknown
R0534:Ep300	UTSW	15	81600896	splice site	probably benign
R0671:Ep300	UTSW	15	81616134	unclassified	probably benign
R0840:Ep300	UTSW	15	81644933	missense	unknown
R1166:Ep300	UTSW	15	81630064	unclassified	probably benign
R1737:Ep300	UTSW	15	81626347	missense	probably damaging	0.99
R1893:Ep300	UTSW	15	81631646	unclassified	probably benign
R2136:Ep300	UTSW	15	81640447	missense	unknown
R3427:Ep300	UTSW	15	81601279	missense	unknown
R3757:Ep300	UTSW	15	81648589	missense	unknown
R3892:Ep300	UTSW	15	81619997	unclassified	probably benign
R4554:Ep300	UTSW	15	81601430	missense	unknown
R4575:Ep300	UTSW	15	81649009	missense	unknown
R4575:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81611410	unclassified	probably benign
R4577:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81649009	missense	unknown
R4578:Ep300	UTSW	15	81611410	unclassified	probably benign
R5021:Ep300	UTSW	15	81640023	missense	unknown
R5366:Ep300	UTSW	15	81616100	missense	probably benign	0.24
R5372:Ep300	UTSW	15	81636830	missense	unknown
R5393:Ep300	UTSW	15	81631618	unclassified	probably benign
R5410:Ep300	UTSW	15	81648854	missense	unknown
R5571:Ep300	UTSW	15	81643217	intron	probably benign
R5701:Ep300	UTSW	15	81601495	missense	unknown
R5772:Ep300	UTSW	15	81639914	intron	probably benign
R5825:Ep300	UTSW	15	81611472	missense	probably benign	0.39
R5917:Ep300	UTSW	15	81628607	unclassified	probably benign
R5991:Ep300	UTSW	15	81648466	missense	unknown
R6019:Ep300	UTSW	15	81641382	missense	unknown
R6144:Ep300	UTSW	15	81601234	missense	unknown
R6291:Ep300	UTSW	15	81648507	missense	unknown
R6292:Ep300	UTSW	15	81616734	unclassified	probably benign
R6599:Ep300	UTSW	15	81586713	missense	unknown
R6804:Ep300	UTSW	15	81641311	nonsense	probably null
R6925:Ep300	UTSW	15	81649981	missense	probably benign	0.32
R7327:Ep300	UTSW	15	81627314	missense	unknown
R7378:Ep300	UTSW	15	81650545	missense	probably damaging	0.97
R7388:Ep300	UTSW	15	81648366	missense	unknown
R7419:Ep300	UTSW	15	81648514	missense	unknown
R7498:Ep300	UTSW	15	81639843	missense	unknown
R7584:Ep300	UTSW	15	81628426	missense	unknown
R7605:Ep300	UTSW	15	81621152	missense	unknown
R7619:Ep300	UTSW	15	81608198	missense	unknown
R7699:Ep300	UTSW	15	81586393	start gained	probably benign
R7763:Ep300	UTSW	15	81586583	start gained	probably benign
R7775:Ep300	UTSW	15	81586686	missense	unknown
R7778:Ep300	UTSW	15	81586686	missense	unknown
R7924:Ep300	UTSW	15	81649502	missense	unknown
R8155:Ep300	UTSW	15	81621068	missense	unknown
R8259:Ep300	UTSW	15	81639017	missense	unknown
R8276:Ep300	UTSW	15	81650028	missense	possibly damaging	0.85
R8331:Ep300	UTSW	15	81601210	missense	unknown
R8554:Ep300	UTSW	15	81639027	missense	unknown
R9019:Ep300	UTSW	15	81648529	missense	unknown
R9128:Ep300	UTSW	15	81649745	missense	unknown
R9379:Ep300	UTSW	15	81648559	missense	unknown
R9380:Ep300	UTSW	15	81616044	missense	unknown
R9484:Ep300	UTSW	15	81636825	missense	unknown
R9659:Ep300	UTSW	15	81621072	missense	unknown
R9690:Ep300	UTSW	15	81636195	missense	unknown
R9721:Ep300	UTSW	15	81608315	missense	unknown
RF020:Ep300	UTSW	15	81586571	start gained	probably benign
Z1177:Ep300	UTSW	15	81630097	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AACAACAGATGGGGTCTCCTG -3'
(R):5'- TTATCGCTGCTCAGTCCCAG -3'

Sequencing Primer
(F):5'- AGATGGGGTCTCCTGCTCAG -3'
(R):5'- AGGTCCGTGGCACTTGC -3'

Posted On

2019-12-20