Mutagenetix > Incidental Mutation

Incidental Mutation 'R7862:Shank3'

607607

Institutional Source

Beutler Lab

Gene Symbol

Shank3

Ensembl Gene

ENSMUSG00000022623

Gene Name

SH3 and multiple ankyrin repeat domains 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R7862 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89499623-89560261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89505445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 415 (D415G)

Ref Sequence

ENSEMBL: ENSMUSP00000104932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000109309]

AlphaFold

Q4ACU6

Predicted Effect

SMART Domains

Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: D340G

Domain	Start	End	E-Value	Type
ANK	182	211	1.54e-1	SMART
ANK	215	245	3.36e2	SMART
ANK	249	278	2.47e0	SMART
ANK	282	311	3.71e-4	SMART
ANK	315	345	5.03e2	SMART
low complexity region	434	462	N/A	INTRINSIC
SH3	473	528	1.28e-14	SMART
PDZ	579	664	3.95e-13	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	813	843	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	905	923	N/A	INTRINSIC
low complexity region	1078	1092	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1173	1194	N/A	INTRINSIC
low complexity region	1235	1252	N/A	INTRINSIC
low complexity region	1266	1278	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1341	1355	N/A	INTRINSIC
low complexity region	1370	1395	N/A	INTRINSIC
low complexity region	1409	1427	N/A	INTRINSIC
low complexity region	1552	1558	N/A	INTRINSIC
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1626	1658	N/A	INTRINSIC
SAM	1664	1730	3.08e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109309
AA Change: D415G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: D415G

Domain	Start	End	E-Value	Type
low complexity region	5	55	N/A	INTRINSIC
Pfam:FERM_f0	84	167	2.5e-14	PFAM
ANK	257	286	1.54e-1	SMART
ANK	290	320	3.36e2	SMART
ANK	324	353	2.47e0	SMART
ANK	357	386	3.71e-4	SMART
ANK	390	420	5.03e2	SMART
low complexity region	509	537	N/A	INTRINSIC
SH3	548	603	1.28e-14	SMART
PDZ	654	739	3.95e-13	SMART
low complexity region	747	759	N/A	INTRINSIC
low complexity region	888	918	N/A	INTRINSIC
low complexity region	932	944	N/A	INTRINSIC
low complexity region	980	998	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC
low complexity region	1184	1196	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1310	1327	N/A	INTRINSIC
low complexity region	1341	1353	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1416	1430	N/A	INTRINSIC
low complexity region	1445	1470	N/A	INTRINSIC
low complexity region	1484	1502	N/A	INTRINSIC
low complexity region	1627	1633	N/A	INTRINSIC
low complexity region	1659	1674	N/A	INTRINSIC
low complexity region	1701	1733	N/A	INTRINSIC
SAM	1739	1805	3.08e-18	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	A	C	3: 145,943,869	*181S	probably null	Het
Abcc10	G	T	17: 46,315,532	S661*	probably null	Het
Abtb2	C	T	2: 103,702,281	R475W	probably damaging	Het
Cep97	T	C	16: 55,905,721	D673G	probably benign	Het
Chaf1b	T	C	16: 93,888,095	M144T	possibly damaging	Het
Chd8	T	C	14: 52,214,277	D1372G	probably damaging	Het
Chmp6	G	A	11: 119,917,010		probably null	Het
Cst12	T	C	2: 148,789,575	V72A	probably damaging	Het
D1Pas1	G	A	1: 186,968,152	G93R	probably damaging	Het
Dhx34	C	A	7: 16,210,523	V589F	probably damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dmrta1	C	A	4: 89,688,324	H6N	probably benign	Het
Dopey2	T	C	16: 93,749,963	L285P	probably damaging	Het
Dpy19l1	T	C	9: 24,475,434	Y188C	probably damaging	Het
Ehbp1l1	C	T	19: 5,720,823	R230Q	probably benign	Het
Ep300	T	G	15: 81,650,753	V2337G	probably damaging	Het
Fh1	A	T	1: 175,614,834	V150E	probably damaging	Het
Fkbp11	G	A	15: 98,726,508	R122*	probably null	Het
Fkbp5	C	T	17: 28,412,039	E251K	probably damaging	Het
Fmnl1	A	G	11: 103,180,930	K88E	probably damaging	Het
Frrs1	T	C	3: 116,891,880	V300A	possibly damaging	Het
Glud1	T	G	14: 34,325,522	L198V	possibly damaging	Het
Gsdmc	A	T	15: 63,777,996	W349R	possibly damaging	Het
Hacd1	T	C	2: 14,045,202	H64R	probably damaging	Het
Haus2	T	A	2: 120,613,089	D75E	probably benign	Het
Hmcn1	A	T	1: 150,806,421	F459L	probably damaging	Het
Ighe	A	T	12: 113,271,808	V272E		Het
Iqgap1	C	T	7: 80,743,888	R647H	probably benign	Het
Jmy	T	C	13: 93,499,195	I38V	possibly damaging	Het
Kcnh1	G	T	1: 192,190,859		probably benign	Het
Kctd20	C	T	17: 28,962,875	A167V	probably damaging	Het
Klhl38	A	T	15: 58,314,999	V525E	probably damaging	Het
Krit1	A	G	5: 3,812,788	D259G	probably damaging	Het
Med1	A	T	11: 98,161,210	C443S	probably benign	Het
Mllt6	T	C	11: 97,665,805	V107A	probably benign	Het
Myl7	A	G	11: 5,897,157	M132T	probably benign	Het
Myo10	T	C	15: 25,666,436	V11A	probably damaging	Het
Nipbl	T	C	15: 8,325,752	I1642V	probably benign	Het
Olfr1256	T	C	2: 89,835,124	T274A	probably benign	Het
Olfr807	T	C	10: 129,755,355	T32A	probably benign	Het
Olfr843	C	A	9: 19,249,440		probably benign	Het
Olfr918	C	T	9: 38,673,328	V39M	probably benign	Het
Pcdhb2	C	T	18: 37,296,060	A362V	probably benign	Het
Pnp2	A	T	14: 50,963,559	D167V	possibly damaging	Het
Rasa1	G	A	13: 85,255,411	T282I	probably damaging	Het
Rp1l1	A	G	14: 64,028,027	D354G	probably damaging	Het
Rpap1	C	T	2: 119,775,412		probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,923		probably benign	Het
Slc12a1	A	G	2: 125,161,094	I182V	probably damaging	Het
Slc6a13	A	G	6: 121,335,630	Y441C	probably damaging	Het
Sltm	G	T	9: 70,572,164	E193*	probably null	Het
Spag9	T	C	11: 94,112,066	I1134T	possibly damaging	Het
Spta1	G	A	1: 174,197,785		probably null	Het
Stk3	A	G	15: 35,115,586	V29A	possibly damaging	Het
Tgfbr1	A	T	4: 47,403,489	I365F	probably damaging	Het
Thpo	C	T	16: 20,728,790	V24I	probably benign	Het
Tle1	A	C	4: 72,199,315	L36R	probably damaging	Het
Togaram2	T	C	17: 71,689,173	V57A	probably benign	Het
Ttll9	C	T	2: 153,006,975	A459V	probably benign	Het
Ush1c	T	C	7: 46,221,424	I330V	probably damaging	Het
Usp34	T	C	11: 23,464,718	M2906T		Het
Vmn2r28	A	T	7: 5,490,614	M111K	probably benign	Het
Vmn2r97	T	C	17: 18,947,154	C557R	probably damaging	Het
Zfp873	T	A	10: 82,060,275	I280K	probably benign	Het

Other mutations in Shank3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Shank3	APN	15	89549416	missense	probably damaging	1.00
IGL01469:Shank3	APN	15	89521274	missense	probably damaging	1.00
IGL01886:Shank3	APN	15	89531663	missense	probably damaging	1.00
IGL01934:Shank3	APN	15	89549846	missense	probably damaging	1.00
IGL01989:Shank3	APN	15	89503299	splice site	probably benign
IGL02004:Shank3	APN	15	89503299	splice site	probably benign
IGL02085:Shank3	APN	15	89503915	critical splice donor site	probably null
IGL02195:Shank3	APN	15	89548118	missense	probably damaging	1.00
IGL02354:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02361:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02541:Shank3	APN	15	89501410	missense	probably damaging	1.00
G1citation:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R0294:Shank3	UTSW	15	89532098	missense	probably damaging	1.00
R0468:Shank3	UTSW	15	89549275	missense	probably benign	0.28
R0483:Shank3	UTSW	15	89543239	splice site	probably benign
R0605:Shank3	UTSW	15	89524147	missense	possibly damaging	0.49
R0675:Shank3	UTSW	15	89531388	missense	possibly damaging	0.92
R1082:Shank3	UTSW	15	89549371	missense	probably damaging	1.00
R1576:Shank3	UTSW	15	89503663	missense	probably benign	0.11
R1702:Shank3	UTSW	15	89499896	missense	probably damaging	0.99
R1726:Shank3	UTSW	15	89557986	missense	probably damaging	1.00
R1958:Shank3	UTSW	15	89503148	missense	probably damaging	0.99
R1961:Shank3	UTSW	15	89557964	missense	possibly damaging	0.60
R2420:Shank3	UTSW	15	89521210	nonsense	probably null
R2513:Shank3	UTSW	15	89548686	missense	probably benign	0.05
R3917:Shank3	UTSW	15	89503384	missense	possibly damaging	0.77
R4163:Shank3	UTSW	15	89549594	missense	probably damaging	1.00
R4205:Shank3	UTSW	15	89503318	missense	probably damaging	1.00
R4434:Shank3	UTSW	15	89503359	missense	probably damaging	1.00
R4791:Shank3	UTSW	15	89500354	missense	probably damaging	1.00
R4816:Shank3	UTSW	15	89543115	missense	probably damaging	1.00
R4828:Shank3	UTSW	15	89500199	intron	probably benign
R4911:Shank3	UTSW	15	89504344	missense	probably damaging	1.00
R4997:Shank3	UTSW	15	89549698	missense	probably damaging	1.00
R5213:Shank3	UTSW	15	89533278	missense	possibly damaging	0.82
R5338:Shank3	UTSW	15	89531711	splice site	probably null
R5494:Shank3	UTSW	15	89548238	missense	probably damaging	0.99
R5543:Shank3	UTSW	15	89532354	missense	probably damaging	1.00
R5654:Shank3	UTSW	15	89521326	missense	probably benign	0.07
R5900:Shank3	UTSW	15	89503390	missense	probably damaging	1.00
R5906:Shank3	UTSW	15	89548916	missense	probably damaging	1.00
R6385:Shank3	UTSW	15	89521375	critical splice donor site	probably null
R6432:Shank3	UTSW	15	89503413	missense	possibly damaging	0.75
R6724:Shank3	UTSW	15	89532453	missense	probably damaging	1.00
R6822:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R6845:Shank3	UTSW	15	89548325	missense	probably benign	0.00
R7088:Shank3	UTSW	15	89503525	splice site	probably null
R7390:Shank3	UTSW	15	89549312	missense	probably benign	0.05
R7808:Shank3	UTSW	15	89548880	missense	probably damaging	1.00
R8039:Shank3	UTSW	15	89505439	missense	probably damaging	1.00
R8090:Shank3	UTSW	15	89505458	critical splice donor site	probably null
R8170:Shank3	UTSW	15	89548840	missense	possibly damaging	0.69
R8189:Shank3	UTSW	15	89549236	missense	probably benign
R8246:Shank3	UTSW	15	89533346	missense	possibly damaging	0.90
R8515:Shank3	UTSW	15	89503572	nonsense	probably null
R8525:Shank3	UTSW	15	89547770	missense	probably damaging	0.99
R8537:Shank3	UTSW	15	89532215	missense	probably damaging	1.00
R8673:Shank3	UTSW	15	89549776	missense	probably damaging	1.00
R8826:Shank3	UTSW	15	89549395	missense	probably damaging	1.00
R8932:Shank3	UTSW	15	89548783	missense	possibly damaging	0.86
R8954:Shank3	UTSW	15	89549228	missense	possibly damaging	0.88
R8976:Shank3	UTSW	15	89558178	missense	probably damaging	1.00
R8992:Shank3	UTSW	15	89548685	missense	possibly damaging	0.95
R8994:Shank3	UTSW	15	89533213	missense	probably benign	0.27
R9130:Shank3	UTSW	15	89558216	missense	probably benign	0.19
R9258:Shank3	UTSW	15	89504318	missense	probably damaging	1.00
R9645:Shank3	UTSW	15	89525250	missense	possibly damaging	0.96
RF020:Shank3	UTSW	15	89500390	missense	probably benign	0.20
Z1177:Shank3	UTSW	15	89558322	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCTAGTTACTGGCATCCTTG -3'
(R):5'- ATTCTGTTCAGTCCACACAGGC -3'

Sequencing Primer
(F):5'- AGGTCCCAGTAGACATTTTGGC -3'
(R):5'- AGTCCACACAGGCTCTTTTTC -3'

Posted On

2019-12-20