Incidental Mutation 'R7862:Thpo'
ID607609
Institutional Source Beutler Lab
Gene Symbol Thpo
Ensembl Gene ENSMUSG00000022847
Gene Namethrombopoietin
SynonymsTPO-3, TPO-1, TPO-2, TPO, TPO-4, myeloproliferative leukemia virus oncogene ligand, Mpllg
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location20724454-20734511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20728790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 24 (V24I)
Ref Sequence ENSEMBL: ENSMUSP00000111097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000076422] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000231826] [ENSMUST00000232217] [ENSMUST00000232646]
Predicted Effect probably benign
Transcript: ENSMUST00000007171
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076422
AA Change: V24I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075756
Gene: ENSMUSG00000022847
AA Change: V24I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 24 188 9.4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115423
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
AA Change: V24I

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847
AA Change: V24I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect probably benign
Transcript: ENSMUST00000231826
AA Change: V24I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000232217
AA Change: V53I

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000232646
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a humoral growth factor necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. The encoded protein is a ligand for the product of the myeloproliferative leukemia virus oncogene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abcc10 G T 17: 46,315,532 S661* probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
D1Pas1 G A 1: 186,968,152 G93R probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Iqgap1 C T 7: 80,743,888 R647H probably benign Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Olfr918 C T 9: 38,673,328 V39M probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Spta1 G A 1: 174,197,785 probably null Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in Thpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Thpo APN 16 20728455 missense probably damaging 0.99
R1595:Thpo UTSW 16 20728456 missense probably damaging 1.00
R3838:Thpo UTSW 16 20728748 missense probably damaging 1.00
R5911:Thpo UTSW 16 20728796 missense probably null 1.00
R6113:Thpo UTSW 16 20728847 unclassified probably benign
R6977:Thpo UTSW 16 20725683 missense probably damaging 0.99
R7769:Thpo UTSW 16 20725651 missense probably benign 0.00
R8079:Thpo UTSW 16 20726394 missense probably benign
R8281:Thpo UTSW 16 20725775 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCCTCTAAGAGACCAATGCC -3'
(R):5'- CTAGAAAAGGGGTCTGTCTGGAC -3'

Sequencing Primer
(F):5'- CCTTGTCAGGGCTAAGACATG -3'
(R):5'- GACAGCAGACCCCTGGATTTC -3'
Posted On2019-12-20