Incidental Mutation 'R0196:Bag6'
Institutional Source Beutler Lab
Gene Symbol Bag6
Ensembl Gene ENSMUSG00000024392
Gene NameBCL2-associated athanogene 6
SynonymsScythe, G3, D17H6S52E, Bat3, 2410045D21Rik
MMRRC Submission 038455-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0196 (G1)
Quality Score83
Status Not validated
Chromosomal Location35135178-35147322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 35144263 bp
Amino Acid Change Glycine to Alanine at position 693 (G693A)
Ref Sequence ENSEMBL: ENSMUSP00000129324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000025253] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173491] [ENSMUST00000173535] [ENSMUST00000173550] [ENSMUST00000174281] [ENSMUST00000173952] [ENSMUST00000174805]
Predicted Effect unknown
Transcript: ENSMUST00000025250
AA Change: G711A
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392
AA Change: G711A

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025253
SMART Domains Protein: ENSMUSP00000025253
Gene: ENSMUSG00000024393

Pfam:BAT2_N 1 189 1.2e-70 PFAM
low complexity region 243 276 N/A INTRINSIC
low complexity region 343 357 N/A INTRINSIC
low complexity region 396 413 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
coiled coil region 455 494 N/A INTRINSIC
low complexity region 504 523 N/A INTRINSIC
low complexity region 527 566 N/A INTRINSIC
low complexity region 593 618 N/A INTRINSIC
low complexity region 643 684 N/A INTRINSIC
low complexity region 687 709 N/A INTRINSIC
low complexity region 711 717 N/A INTRINSIC
low complexity region 755 768 N/A INTRINSIC
low complexity region 826 833 N/A INTRINSIC
low complexity region 861 871 N/A INTRINSIC
low complexity region 882 894 N/A INTRINSIC
low complexity region 902 924 N/A INTRINSIC
low complexity region 944 966 N/A INTRINSIC
low complexity region 1032 1070 N/A INTRINSIC
low complexity region 1129 1149 N/A INTRINSIC
low complexity region 1162 1179 N/A INTRINSIC
low complexity region 1190 1211 N/A INTRINSIC
low complexity region 1234 1242 N/A INTRINSIC
low complexity region 1285 1300 N/A INTRINSIC
low complexity region 1346 1360 N/A INTRINSIC
low complexity region 1394 1424 N/A INTRINSIC
low complexity region 1430 1456 N/A INTRINSIC
low complexity region 1488 1511 N/A INTRINSIC
low complexity region 1553 1565 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
internal_repeat_1 1810 1860 5.56e-5 PROSPERO
low complexity region 1879 1895 N/A INTRINSIC
internal_repeat_1 1924 1983 5.56e-5 PROSPERO
low complexity region 1995 2017 N/A INTRINSIC
low complexity region 2019 2041 N/A INTRINSIC
low complexity region 2070 2086 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166426
AA Change: G693A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392
AA Change: G693A

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172571
AA Change: G688A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392
AA Change: G688A

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172925
Predicted Effect probably benign
Transcript: ENSMUST00000172993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173351
Predicted Effect probably benign
Transcript: ENSMUST00000173491
SMART Domains Protein: ENSMUSP00000134279
Gene: ENSMUSG00000024392

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173535
SMART Domains Protein: ENSMUSP00000133822
Gene: ENSMUSG00000024392

signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 261 280 N/A INTRINSIC
low complexity region 287 305 N/A INTRINSIC
Pfam:DUF3538 318 434 1.3e-53 PFAM
low complexity region 468 479 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173550
AA Change: G728A
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392
AA Change: G728A

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173558
Predicted Effect unknown
Transcript: ENSMUST00000174281
AA Change: G746A
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392
AA Change: G746A

UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174613
Predicted Effect probably benign
Transcript: ENSMUST00000173952
SMART Domains Protein: ENSMUSP00000134717
Gene: ENSMUSG00000024392

signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174805
SMART Domains Protein: ENSMUSP00000133550
Gene: ENSMUSG00000024393

Pfam:BAT2_N 1 137 6.6e-53 PFAM
low complexity region 188 221 N/A INTRINSIC
low complexity region 288 302 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
coiled coil region 400 439 N/A INTRINSIC
low complexity region 449 468 N/A INTRINSIC
low complexity region 472 511 N/A INTRINSIC
low complexity region 538 563 N/A INTRINSIC
low complexity region 588 629 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 656 662 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
low complexity region 771 778 N/A INTRINSIC
low complexity region 806 816 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 847 869 N/A INTRINSIC
low complexity region 889 911 N/A INTRINSIC
low complexity region 977 1015 N/A INTRINSIC
low complexity region 1074 1094 N/A INTRINSIC
low complexity region 1107 1124 N/A INTRINSIC
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1179 1187 N/A INTRINSIC
low complexity region 1230 1245 N/A INTRINSIC
low complexity region 1291 1305 N/A INTRINSIC
low complexity region 1339 1369 N/A INTRINSIC
low complexity region 1375 1401 N/A INTRINSIC
low complexity region 1433 1456 N/A INTRINSIC
low complexity region 1498 1510 N/A INTRINSIC
low complexity region 1638 1658 N/A INTRINSIC
internal_repeat_1 1755 1804 3.99e-5 PROSPERO
low complexity region 1823 1839 N/A INTRINSIC
internal_repeat_1 1868 1927 3.99e-5 PROSPERO
low complexity region 1939 1961 N/A INTRINSIC
low complexity region 1963 1985 N/A INTRINSIC
low complexity region 2014 2030 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 81.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in either embryonic lethality following abnormal brain development or neonatal death associated with severe developmental defects in the lung and kidney. These developmental defects are associated with widespread aberrant apoptosis and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik A G 2: 68,616,247 probably benign Het
Aass G A 6: 23,109,520 P317L probably damaging Het
Abca12 T A 1: 71,259,813 N2313I possibly damaging Het
Adamts12 T C 15: 11,071,508 I46T probably benign Het
Adipoq T G 16: 23,146,643 probably null Het
Amy1 A T 3: 113,569,421 D92E probably benign Het
Asb15 G A 6: 24,564,393 R282Q probably damaging Het
Birc6 T C 17: 74,580,287 I870T possibly damaging Het
Cand2 A G 6: 115,789,502 K356R probably damaging Het
Cbfa2t3 T C 8: 122,633,337 Q525R possibly damaging Het
Ccdc94 C A 17: 55,964,653 D191E probably damaging Het
Cd4 T C 6: 124,867,806 R339G probably damaging Het
Cdh8 A G 8: 99,190,434 S350P probably damaging Het
Cep295 A T 9: 15,338,213 S469T probably damaging Het
Ckap2l A T 2: 129,285,422 S279T probably benign Het
Clnk T A 5: 38,769,939 N66Y probably damaging Het
Col27a1 A T 4: 63,224,266 T64S probably benign Het
Crtc1 T C 8: 70,386,221 D599G probably damaging Het
Cyp2c23 A C 19: 44,012,356 I363S probably damaging Het
Dnah10 A T 5: 124,834,075 I4519F possibly damaging Het
Dner T A 1: 84,370,832 I716F probably damaging Het
Dsel T G 1: 111,861,603 T401P possibly damaging Het
Egfr A G 11: 16,911,746 D1175G probably benign Het
Ephb3 A T 16: 21,218,054 N343I probably damaging Het
Fbxw10 T A 11: 62,877,244 F974I probably benign Het
Gfi1b T C 2: 28,613,774 Y138C probably damaging Het
Gm11168 T A 9: 3,005,175 L6H probably benign Het
Grb10 A C 11: 11,945,583 V247G probably damaging Het
Gstp2 A T 19: 4,040,514 probably null Het
Hars2 C T 18: 36,789,204 Q291* probably null Het
Hyal4 G T 6: 24,756,221 W146L probably damaging Het
Il22ra1 C T 4: 135,734,245 T107I possibly damaging Het
Itga8 A G 2: 12,204,729 probably null Het
Klhl25 T C 7: 75,865,702 S119P probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lrrc8c T C 5: 105,606,770 V137A probably benign Het
Macrod2 A T 2: 142,176,625 E226V probably damaging Het
Mcemp1 A T 8: 3,668,201 Q165L probably benign Het
Mcpt9 T A 14: 56,027,996 K82M probably benign Het
Mpzl3 A G 9: 45,062,160 T66A probably damaging Het
Msh6 G A 17: 87,980,360 V143I possibly damaging Het
Mug1 G A 6: 121,838,725 probably null Het
Ncr1 G T 7: 4,340,973 C153F probably damaging Het
Nf1 T A 11: 79,468,769 M1411K possibly damaging Het
Nf1 T A 11: 79,578,272 V786D probably damaging Het
Nisch T C 14: 31,203,394 probably benign Het
Nwd2 T A 5: 63,806,351 Y1093N probably benign Het
Oas3 G A 5: 120,756,145 R39C probably damaging Het
Olfr1352 C T 10: 78,984,189 T133I possibly damaging Het
Olfr392 A T 11: 73,814,905 M59K probably damaging Het
Oxa1l T C 14: 54,363,487 I139T probably damaging Het
P3h3 T A 6: 124,845,272 N583Y probably damaging Het
Pcdh18 A T 3: 49,756,698 probably null Het
Pcnp C T 16: 56,024,533 probably benign Het
Pdzd8 G T 19: 59,301,131 D612E probably benign Het
Pi4kb T C 3: 94,998,950 S8P probably damaging Het
Pikfyve T G 1: 65,256,072 V1454G possibly damaging Het
Podn T C 4: 108,021,498 N246D probably damaging Het
Prg4 T C 1: 150,454,492 probably benign Het
R3hdm2 T C 10: 127,484,521 Y523H probably damaging Het
Rpf1 T A 3: 146,508,149 E231V possibly damaging Het
Slc16a10 C T 10: 40,056,615 E317K probably benign Het
Slc34a1 A T 13: 55,412,265 I435F probably damaging Het
Snx19 A G 9: 30,433,387 D629G probably damaging Het
Tomm70a T C 16: 57,146,100 I472T probably benign Het
Trp53 A G 11: 69,588,680 Y202C probably damaging Het
Ttc14 T A 3: 33,809,254 probably benign Het
Ugt1a1 C T 1: 88,212,555 A185V possibly damaging Het
Usp28 A G 9: 49,028,278 D655G probably damaging Het
Vmn1r215 C T 13: 23,076,084 T98I probably damaging Het
Vmn2r121 G T X: 124,132,182 T426N probably benign Het
Vmn2r99 A G 17: 19,394,573 N852D probably benign Het
Xrn2 T A 2: 147,047,660 D654E probably damaging Het
Zfp335 C G 2: 164,896,145 A849P possibly damaging Het
Zfp954 C T 7: 7,115,391 V385M probably damaging Het
Zmynd15 A G 11: 70,464,226 T350A probably damaging Het
Other mutations in Bag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL00489:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL01613:Bag6 APN 17 35143016 unclassified probably benign
IGL01735:Bag6 APN 17 35145761 unclassified probably benign
IGL02146:Bag6 APN 17 35136215 missense probably damaging 1.00
IGL03092:Bag6 APN 17 35145627 missense probably damaging 1.00
IGL03377:Bag6 APN 17 35144982 missense probably damaging 1.00
Hunter UTSW 17 35145238 splice site probably null
R0449:Bag6 UTSW 17 35141466 missense probably damaging 1.00
R1228:Bag6 UTSW 17 35145333 missense probably damaging 0.99
R1450:Bag6 UTSW 17 35141958 missense probably benign 0.01
R1686:Bag6 UTSW 17 35144952 missense possibly damaging 0.84
R1869:Bag6 UTSW 17 35142826 missense probably benign 0.05
R2034:Bag6 UTSW 17 35144692 missense probably damaging 0.99
R2205:Bag6 UTSW 17 35144607 missense probably damaging 1.00
R2428:Bag6 UTSW 17 35147175 missense probably damaging 1.00
R2987:Bag6 UTSW 17 35145685 nonsense probably null
R4691:Bag6 UTSW 17 35139248 missense probably damaging 1.00
R4705:Bag6 UTSW 17 35142343 missense probably damaging 1.00
R4905:Bag6 UTSW 17 35145186 missense probably damaging 1.00
R5001:Bag6 UTSW 17 35145176 missense probably damaging 1.00
R5168:Bag6 UTSW 17 35144695 missense probably damaging 1.00
R5808:Bag6 UTSW 17 35146322 missense probably damaging 1.00
R6118:Bag6 UTSW 17 35143624 missense probably damaging 0.99
R6212:Bag6 UTSW 17 35140302 missense probably benign 0.17
R6279:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6300:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6564:Bag6 UTSW 17 35140371 missense probably damaging 0.98
R6783:Bag6 UTSW 17 35144235 missense possibly damaging 0.94
R6927:Bag6 UTSW 17 35145922 critical splice donor site probably null
R7226:Bag6 UTSW 17 35142945 missense unknown
R7490:Bag6 UTSW 17 35140842 missense unknown
R7499:Bag6 UTSW 17 35144392 missense probably benign 0.29
R7688:Bag6 UTSW 17 35146892 missense probably damaging 0.99
R8016:Bag6 UTSW 17 35138757 missense unknown
R8066:Bag6 UTSW 17 35142307 missense unknown
R8189:Bag6 UTSW 17 35145238 splice site probably null
R8424:Bag6 UTSW 17 35146854 missense probably damaging 1.00
R8542:Bag6 UTSW 17 35144358 missense probably damaging 1.00
X0025:Bag6 UTSW 17 35146077 nonsense probably null
Z1176:Bag6 UTSW 17 35139310 critical splice donor site probably null
Z1177:Bag6 UTSW 17 35142924 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agaatgcccatacacaataaatacag -3'
Posted On2013-07-24