Incidental Mutation 'R7863:Ticrr'
ID 607653
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045916-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R7863 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79331760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 757 (V757A)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect possibly damaging
Transcript: ENSMUST00000035977
AA Change: V757A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: V757A

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect possibly damaging
Transcript: ENSMUST00000206591
AA Change: V757A

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,838,101 (GRCm39) S829P probably benign Het
Abca1 A T 4: 53,107,179 (GRCm39) F183I probably benign Het
Abca12 A T 1: 71,332,656 (GRCm39) M1235K probably damaging Het
Abca7 A G 10: 79,844,655 (GRCm39) D1488G probably damaging Het
Adgrl3 A G 5: 81,660,596 (GRCm39) Y387C probably damaging Het
Adnp T C 2: 168,031,270 (GRCm39) K14E possibly damaging Het
Ago3 T C 4: 126,243,990 (GRCm39) R721G possibly damaging Het
Aldh3b3 T A 19: 4,015,322 (GRCm39) Y196* probably null Het
Alox12b T C 11: 69,057,753 (GRCm39) W506R probably damaging Het
Arid4b A G 13: 14,338,734 (GRCm39) I402V probably benign Het
Cep55 C T 19: 38,046,247 (GRCm39) probably benign Het
Chl1 A G 6: 103,683,475 (GRCm39) N767S possibly damaging Het
Cldn6 A G 17: 23,900,096 (GRCm39) N20S probably benign Het
Col23a1 A T 11: 51,463,597 (GRCm39) I420F probably damaging Het
Cxcr6 G A 9: 123,639,914 (GRCm39) R312Q probably damaging Het
Cyp4a10 T C 4: 115,375,622 (GRCm39) V35A probably benign Het
Def6 A G 17: 28,446,841 (GRCm39) N548D possibly damaging Het
Dock6 A G 9: 21,757,954 (GRCm39) V50A possibly damaging Het
Epha8 T A 4: 136,660,966 (GRCm39) I639F probably damaging Het
Ephx2 T A 14: 66,344,692 (GRCm39) R211* probably null Het
Espn C T 4: 152,236,616 (GRCm39) V17M probably damaging Het
Ezr A G 17: 7,008,863 (GRCm39) L403P probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Golm1 T C 13: 59,797,383 (GRCm39) Y154C probably damaging Het
Gpam A G 19: 55,059,388 (GRCm39) Y820H probably damaging Het
Gpr12 T C 5: 146,520,370 (GRCm39) D184G possibly damaging Het
Gpr87 C T 3: 59,087,317 (GRCm39) A63T probably damaging Het
Hmx2 G T 7: 131,156,082 (GRCm39) G16V probably benign Het
Hspg2 T C 4: 137,292,135 (GRCm39) V4009A probably benign Het
Iglc3 T C 16: 18,884,248 (GRCm39) D61G not run Het
Ikzf2 G T 1: 69,609,796 (GRCm39) Q144K possibly damaging Het
Il1rap C T 16: 26,495,461 (GRCm39) R23C probably damaging Het
Kctd9 T A 14: 67,967,166 (GRCm39) D161E possibly damaging Het
Klhl8 T C 5: 104,019,968 (GRCm39) N351S probably benign Het
Krt28 G A 11: 99,255,999 (GRCm39) T420I possibly damaging Het
Marchf7 T A 2: 60,071,366 (GRCm39) H623Q probably benign Het
Max A G 12: 76,986,848 (GRCm39) I63T probably damaging Het
Mrpl28 T A 17: 26,343,615 (GRCm39) V125E possibly damaging Het
Mtmr10 T A 7: 63,969,205 (GRCm39) D322E probably benign Het
Mtrex T C 13: 113,045,435 (GRCm39) T366A probably benign Het
Nlrp4f A T 13: 65,342,059 (GRCm39) Y529N possibly damaging Het
Nlrx1 A G 9: 44,176,509 (GRCm39) I31T probably benign Het
Oaz2 G A 9: 65,596,449 (GRCm39) R171Q possibly damaging Het
Or4c121 T G 2: 89,024,295 (GRCm39) I28L probably benign Het
Or5a1 T G 19: 12,097,974 (GRCm39) D34A possibly damaging Het
Or5t16 T G 2: 86,819,424 (GRCm39) Y32S probably damaging Het
Pcdhgc4 T A 18: 37,951,027 (GRCm39) Y814* probably null Het
Pcm1 T A 8: 41,714,163 (GRCm39) I243K probably damaging Het
Pdcd11 A T 19: 47,085,403 (GRCm39) N171I probably damaging Het
Phf20l1 T A 15: 66,487,084 (GRCm39) V400E possibly damaging Het
Pira13 C T 7: 3,827,801 (GRCm39) probably null Het
Psg28 T A 7: 18,162,042 (GRCm39) T154S possibly damaging Het
Ptgs2 T A 1: 149,977,090 (GRCm39) M99K probably damaging Het
Ptprh T A 7: 4,606,097 (GRCm39) M1L probably benign Het
Rbp4 T C 19: 38,112,546 (GRCm39) T140A possibly damaging Het
Rhbdd3 G A 11: 5,053,236 (GRCm39) R12Q probably benign Het
Saal1 T C 7: 46,342,327 (GRCm39) N372S probably benign Het
Satb1 T C 17: 52,112,350 (GRCm39) E88G possibly damaging Het
Shfl G A 9: 20,782,672 (GRCm39) A79T possibly damaging Het
Slc49a3 A T 5: 108,593,400 (GRCm39) L146Q probably damaging Het
Slc6a9 G T 4: 117,721,207 (GRCm39) C319F probably damaging Het
Smc6 T G 12: 11,339,130 (GRCm39) V322G probably benign Het
Snrnp200 T A 2: 127,073,609 (GRCm39) F1336I probably damaging Het
Spg7 T A 8: 123,815,788 (GRCm39) probably null Het
Stab2 G A 10: 86,808,745 (GRCm39) T188I probably benign Het
Tbata A G 10: 61,011,521 (GRCm39) E19G probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tle1 T C 4: 72,059,529 (GRCm39) S261G probably null Het
Tlr3 T A 8: 45,850,774 (GRCm39) I708L probably benign Het
Tph2 A C 10: 114,915,906 (GRCm39) S422R probably damaging Het
Trim26 A G 17: 37,161,664 (GRCm39) T28A probably damaging Het
Trmt10c A G 16: 55,855,554 (GRCm39) L27S probably benign Het
Tubb6 T C 18: 67,534,790 (GRCm39) S230P probably damaging Het
Usf1 C T 1: 171,245,385 (GRCm39) Q266* probably null Het
Vegfa A G 17: 46,336,461 (GRCm39) F220L probably damaging Het
Vmn2r105 C T 17: 20,428,937 (GRCm39) C713Y probably benign Het
Vmn2r17 T A 5: 109,568,035 (GRCm39) S53T probably benign Het
Xirp2 A T 2: 67,343,074 (GRCm39) T1772S probably benign Het
Zfp462 T C 4: 55,007,747 (GRCm39) I62T probably benign Het
Zfp516 T A 18: 83,019,453 (GRCm39) I1157N probably benign Het
Zfp819 C A 7: 43,267,316 (GRCm39) Q600K probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TTGTTTCCTCCAGGTGCCAG -3'
(R):5'- CATAGAACTGAAGTTACCAGCATG -3'

Sequencing Primer
(F):5'- CAGGTGCCAGCTTCAGGTATTTC -3'
(R):5'- CACCATGTGTAGTGGTTGTT -3'
Posted On 2019-12-20