Mutagenetix > Incidental Mutation

Incidental Mutation 'R7864:Scn9a'

607702

Institutional Source

Beutler Lab

Gene Symbol

Scn9a

Ensembl Gene

ENSMUSG00000075316

Gene Name

sodium channel, voltage-gated, type IX, alpha

Synonyms

PN1

MMRRC Submission

045917-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66480080-66634962 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 66484560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1605 (T1605S)

Ref Sequence

ENSEMBL: ENSMUSP00000097642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]

AlphaFold

Q62205

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100063
AA Change: T1596S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: T1596S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	403	9.5e-78	PFAM
coiled coil region	404	442	N/A	INTRINSIC
Pfam:DUF3451	465	685	1.3e-62	PFAM
Pfam:Ion_trans	768	957	9.9e-48	PFAM
Pfam:Na_trans_assoc	972	1191	2.9e-72	PFAM
low complexity region	1203	1214	N/A	INTRINSIC
Pfam:Ion_trans	1217	1445	2.8e-55	PFAM
PDB:1BYY\|A	1447	1499	9e-27	PDB
Pfam:Ion_trans	1538	1748	3.4e-52	PFAM
Pfam:PKD_channel	1599	1755	1.1e-7	PFAM
IQ	1877	1899	1.03e-3	SMART
low complexity region	1956	1972	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100064
AA Change: T1605S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: T1605S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	125	412	2.2e-84	PFAM
low complexity region	433	446	N/A	INTRINSIC
Pfam:Na_trans_cytopl	483	693	7.5e-76	PFAM
Pfam:Ion_trans	742	977	4.1e-57	PFAM
Pfam:Na_trans_assoc	981	1185	1.4e-58	PFAM
Pfam:Ion_trans	1189	1466	7e-67	PFAM
Pfam:Ion_trans	1512	1769	1e-55	PFAM
Pfam:PKD_channel	1605	1763	2.6e-7	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112354
AA Change: T1594S

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: T1594S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.2e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164384
AA Change: T1605S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: T1605S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	1.1e-77	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	694	4.2e-66	PFAM
Pfam:Ion_trans	777	966	8.8e-48	PFAM
Pfam:Na_trans_assoc	981	1200	6e-72	PFAM
low complexity region	1212	1223	N/A	INTRINSIC
Pfam:Ion_trans	1226	1454	2.5e-55	PFAM
PDB:1BYY\|A	1456	1508	6e-29	PDB
Pfam:Ion_trans	1547	1757	3e-52	PFAM
Pfam:PKD_channel	1608	1764	8.1e-8	PFAM
IQ	1886	1908	1.03e-3	SMART
low complexity region	1965	1981	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169900
AA Change: T1594S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: T1594S

Domain	Start	End	E-Value	Type
low complexity region	29	49	N/A	INTRINSIC
Pfam:Ion_trans	154	401	3.7e-78	PFAM
coiled coil region	402	449	N/A	INTRINSIC
Pfam:DUF3451	463	683	1.3e-62	PFAM
Pfam:Ion_trans	766	955	9.9e-48	PFAM
Pfam:Na_trans_assoc	970	1189	2.9e-72	PFAM
low complexity region	1201	1212	N/A	INTRINSIC
Pfam:Ion_trans	1215	1443	2.8e-55	PFAM
PDB:1BYY\|A	1445	1497	7e-29	PDB
Pfam:Ion_trans	1536	1746	3.4e-52	PFAM
Pfam:PKD_channel	1597	1753	1.1e-7	PFAM
IQ	1875	1897	1.03e-3	SMART
low complexity region	1954	1970	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	C	T	12: 83,988,022	R41W	probably benign	Het
Adam32	T	A	8: 24,922,276	H88L	probably benign	Het
Ank1	A	G	8: 23,087,960	T238A	probably damaging	Het
Arid1b	T	C	17: 5,342,255	L1967P	probably damaging	Het
Bbx	G	T	16: 50,262,434	H216Q	probably damaging	Het
C030005K15Rik	G	A	10: 97,725,752	T39M	probably damaging	Het
C1s2	A	G	6: 124,625,287	V655A	probably benign	Het
Carmil2	A	G	8: 105,688,274	Y184C	probably damaging	Het
Ces1f	G	A	8: 93,274,141	A125V	possibly damaging	Het
Chaf1a	C	T	17: 56,047,339	T203I	unknown	Het
Cntn5	A	G	9: 9,984,177	S144P	probably damaging	Het
Cpa5	A	T	6: 30,631,395	Y436F	probably damaging	Het
Dbf4	A	T	5: 8,410,010	H150Q	possibly damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dock8	A	T	19: 25,163,500	D1360V	possibly damaging	Het
Ecm1	A	T	3: 95,734,376	I515N	probably benign	Het
Fancc	A	T	13: 63,400,259	C75*	probably null	Het
Foxa1	A	T	12: 57,542,747	V229D	probably damaging	Het
Gga1	T	C	15: 78,888,244	M248T	probably damaging	Het
Gm1527	A	G	3: 28,926,470	Q573R	probably benign	Het
Gm5615	A	T	9: 36,534,451	F68Y	probably benign	Het
Hivep1	A	C	13: 42,158,814	H1510P	probably benign	Het
Htr1f	A	C	16: 64,926,794	I45S	probably damaging	Het
Itsn1	T	C	16: 91,801,566	V129A	possibly damaging	Het
Klrg2	G	T	6: 38,628,089	Q347K	possibly damaging	Het
Lama2	G	A	10: 27,056,615	T1996I	probably benign	Het
Man1a	C	A	10: 54,030,747	L219F	possibly damaging	Het
Mcub	A	G	3: 129,918,623	I201T	probably damaging	Het
Olfr1494	A	G	19: 13,749,346	D80G	probably benign	Het
Otogl	A	G	10: 107,869,567	L633P	probably damaging	Het
Pik3ca	T	A	3: 32,443,613	L429*	probably null	Het
Pkhd1l1	T	C	15: 44,526,053		probably null	Het
Pld4	C	A	12: 112,765,123	Q237K	probably damaging	Het
Plekhm2	T	C	4: 141,628,046	E897G	probably damaging	Het
Pomt2	A	G	12: 87,122,882	F475L	probably benign	Het
Popdc3	G	A	10: 45,315,182	A130T	probably benign	Het
Prss54	T	C	8: 95,559,669	K259E	probably benign	Het
Psg23	T	G	7: 18,610,510	N340T	possibly damaging	Het
Rab1a	G	T	11: 20,215,673	G23*	probably null	Het
Rgs9	A	T	11: 109,275,620	F108Y	probably damaging	Het
Sh2d4b	G	A	14: 40,840,251	T319I	probably damaging	Het
Slc28a3	A	T	13: 58,578,403		probably null	Het
Syngap1	A	T	17: 26,970,528	Q1286L		Het
Tmem132d	G	A	5: 127,783,916	T1047I	probably damaging	Het
Togaram2	G	A	17: 71,700,940	R420H	probably damaging	Het
Uimc1	G	A	13: 55,093,267	R3*	probably null	Het
Vmn2r7	C	T	3: 64,691,526	V537I	probably benign	Het
Wwp1	T	A	4: 19,635,328	K584N	probably damaging	Het
Zc3h12d	A	T	10: 7,839,959	Q42L	possibly damaging	Het
Zfp729a	A	T	13: 67,621,450	V220E	probably benign	Het
Zfp91	A	G	19: 12,771,039	V391A	probably damaging	Het

Other mutations in Scn9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Scn9a	APN	2	66563601	missense	probably damaging	1.00
IGL00570:Scn9a	APN	2	66484142	missense	probably damaging	1.00
IGL00809:Scn9a	APN	2	66483935	missense	probably damaging	1.00
IGL00977:Scn9a	APN	2	66484301	missense	probably damaging	0.99
IGL01120:Scn9a	APN	2	66526972	missense	probably benign	0.00
IGL01134:Scn9a	APN	2	66504968	missense	probably damaging	1.00
IGL01300:Scn9a	APN	2	66488053	nonsense	probably null
IGL01452:Scn9a	APN	2	66527072	missense	probably damaging	1.00
IGL01531:Scn9a	APN	2	66537378	missense	probably benign	0.11
IGL01572:Scn9a	APN	2	66493886	missense	probably benign	0.00
IGL01645:Scn9a	APN	2	66487642	missense	possibly damaging	0.62
IGL01823:Scn9a	APN	2	66484042	missense	probably damaging	1.00
IGL01965:Scn9a	APN	2	66484433	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66547135	missense	probably damaging	1.00
IGL02127:Scn9a	APN	2	66494826	missense	probably damaging	1.00
IGL02166:Scn9a	APN	2	66493103	missense	possibly damaging	0.95
IGL02183:Scn9a	APN	2	66484611	splice site	probably benign
IGL02640:Scn9a	APN	2	66536096	critical splice donor site	probably null
IGL02685:Scn9a	APN	2	66537293	missense	probably damaging	1.00
IGL02798:Scn9a	APN	2	66540559	missense	possibly damaging	0.52
IGL02832:Scn9a	APN	2	66568029	missense	probably damaging	1.00
IGL03008:Scn9a	APN	2	66562511	missense	probably damaging	1.00
IGL03270:Scn9a	APN	2	66484014	missense	probably damaging	1.00
IGL03408:Scn9a	APN	2	66526747	missense	probably benign	0.00
BB007:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
BB017:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R0039:Scn9a	UTSW	2	66562444	missense	probably damaging	0.98
R0173:Scn9a	UTSW	2	66533093	missense	probably damaging	1.00
R0323:Scn9a	UTSW	2	66568131	missense	probably damaging	1.00
R0344:Scn9a	UTSW	2	66505010	missense	probably damaging	0.99
R0421:Scn9a	UTSW	2	66543277	missense	probably benign
R0465:Scn9a	UTSW	2	66526996	missense	probably damaging	1.00
R0514:Scn9a	UTSW	2	66483678	missense	probably damaging	1.00
R0599:Scn9a	UTSW	2	66526799	missense	probably damaging	0.96
R0627:Scn9a	UTSW	2	66537377	missense	probably benign	0.00
R0644:Scn9a	UTSW	2	66533061	critical splice donor site	probably null
R0653:Scn9a	UTSW	2	66533377	missense	probably damaging	1.00
R0685:Scn9a	UTSW	2	66483499	missense	probably benign	0.02
R0718:Scn9a	UTSW	2	66547112	missense	probably damaging	1.00
R0827:Scn9a	UTSW	2	66536124	nonsense	probably null
R0890:Scn9a	UTSW	2	66483735	missense	probably damaging	1.00
R1139:Scn9a	UTSW	2	66504997	missense	probably benign	0.02
R1385:Scn9a	UTSW	2	66563542	missense	probably damaging	1.00
R1398:Scn9a	UTSW	2	66484586	missense	probably benign	0.11
R1496:Scn9a	UTSW	2	66526888	missense	probably benign
R1511:Scn9a	UTSW	2	66526813	missense	probably benign	0.01
R1517:Scn9a	UTSW	2	66505027	splice site	probably benign
R1564:Scn9a	UTSW	2	66484304	missense	probably damaging	1.00
R1634:Scn9a	UTSW	2	66488017	missense	probably damaging	1.00
R1662:Scn9a	UTSW	2	66483459	missense	probably benign	0.00
R1695:Scn9a	UTSW	2	66504876	nonsense	probably null
R1709:Scn9a	UTSW	2	66483506	missense	probably damaging	1.00
R1741:Scn9a	UTSW	2	66487594	missense	probably damaging	0.99
R1755:Scn9a	UTSW	2	66501716	missense	probably benign	0.38
R1914:Scn9a	UTSW	2	66566250	missense	probably damaging	1.00
R1962:Scn9a	UTSW	2	66484311	missense	probably damaging	1.00
R1970:Scn9a	UTSW	2	66515380	missense	probably damaging	0.97
R2017:Scn9a	UTSW	2	66515321	missense	probably damaging	0.99
R2092:Scn9a	UTSW	2	66533376	missense	probably damaging	0.99
R2105:Scn9a	UTSW	2	66568183	missense	probably benign	0.25
R2114:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2115:Scn9a	UTSW	2	66484052	missense	probably damaging	1.00
R2128:Scn9a	UTSW	2	66526654	missense	probably damaging	1.00
R2157:Scn9a	UTSW	2	66536325	missense	probably damaging	1.00
R2162:Scn9a	UTSW	2	66534229	missense	probably damaging	0.98
R2350:Scn9a	UTSW	2	66504968	missense	probably damaging	1.00
R3694:Scn9a	UTSW	2	66562405	missense	probably benign
R3771:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3772:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3773:Scn9a	UTSW	2	66483648	missense	probably benign	0.26
R3922:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R3926:Scn9a	UTSW	2	66526873	missense	possibly damaging	0.88
R4258:Scn9a	UTSW	2	66565054	intron	probably benign
R4385:Scn9a	UTSW	2	66484556	missense	probably damaging	1.00
R4415:Scn9a	UTSW	2	66526693	missense	probably damaging	1.00
R4570:Scn9a	UTSW	2	66483558	missense	possibly damaging	0.85
R4682:Scn9a	UTSW	2	66547018	missense	probably benign
R4783:Scn9a	UTSW	2	66540623	missense	probably benign	0.01
R4822:Scn9a	UTSW	2	66483749	missense	possibly damaging	0.55
R4829:Scn9a	UTSW	2	66551713	missense	probably benign
R4908:Scn9a	UTSW	2	66526743	missense	probably benign	0.03
R4983:Scn9a	UTSW	2	66566270	missense	probably benign	0.02
R5047:Scn9a	UTSW	2	66562480	missense	probably damaging	1.00
R5100:Scn9a	UTSW	2	66534119	missense	probably damaging	1.00
R5140:Scn9a	UTSW	2	66565167	missense	possibly damaging	0.81
R5398:Scn9a	UTSW	2	66488043	missense	probably damaging	1.00
R5557:Scn9a	UTSW	2	66547103	missense	probably damaging	0.99
R5582:Scn9a	UTSW	2	66565029	intron	probably benign
R6108:Scn9a	UTSW	2	66484049	missense	probably damaging	1.00
R6115:Scn9a	UTSW	2	66563629	missense	possibly damaging	0.70
R6143:Scn9a	UTSW	2	66487524	missense	probably benign	0.00
R6261:Scn9a	UTSW	2	66483896	missense	probably damaging	1.00
R6335:Scn9a	UTSW	2	66568264	start codon destroyed	possibly damaging	0.91
R6429:Scn9a	UTSW	2	66526963	missense	possibly damaging	0.95
R6632:Scn9a	UTSW	2	66483502	missense	probably benign	0.23
R6681:Scn9a	UTSW	2	66563342	missense	possibly damaging	0.90
R6830:Scn9a	UTSW	2	66568029	missense	probably damaging	1.00
R7102:Scn9a	UTSW	2	66549015	missense	probably damaging	1.00
R7186:Scn9a	UTSW	2	66534223	missense	probably damaging	1.00
R7243:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R7311:Scn9a	UTSW	2	66484404	missense	possibly damaging	0.54
R7328:Scn9a	UTSW	2	66484587	missense	probably benign
R7386:Scn9a	UTSW	2	66540550	missense	probably damaging	1.00
R7438:Scn9a	UTSW	2	66547187	missense	possibly damaging	0.81
R7483:Scn9a	UTSW	2	66533348	missense	probably damaging	0.99
R7485:Scn9a	UTSW	2	66534217	missense	probably damaging	1.00
R7526:Scn9a	UTSW	2	66483646	missense	probably benign
R7617:Scn9a	UTSW	2	66540549	missense	possibly damaging	0.55
R7642:Scn9a	UTSW	2	66536236	missense	probably benign	0.02
R7653:Scn9a	UTSW	2	66527080	missense	probably damaging	1.00
R7747:Scn9a	UTSW	2	66484298	missense	probably damaging	1.00
R7823:Scn9a	UTSW	2	66483791	missense	probably damaging	1.00
R7890:Scn9a	UTSW	2	66543112	missense	probably benign	0.00
R7930:Scn9a	UTSW	2	66504849	missense	probably damaging	0.99
R7975:Scn9a	UTSW	2	66484253	missense	probably damaging	1.00
R8057:Scn9a	UTSW	2	66515430	missense	probably benign	0.06
R8145:Scn9a	UTSW	2	66487410	missense	probably damaging	1.00
R8163:Scn9a	UTSW	2	66484401	missense	probably damaging	1.00
R8165:Scn9a	UTSW	2	66540530	missense	probably damaging	1.00
R8342:Scn9a	UTSW	2	66536282	missense	probably benign
R8345:Scn9a	UTSW	2	66494622	missense	probably damaging	0.96
R8464:Scn9a	UTSW	2	66566281	missense	probably damaging	0.99
R8467:Scn9a	UTSW	2	66501671	missense	probably damaging	1.00
R8698:Scn9a	UTSW	2	66536284	missense	probably benign	0.00
R8810:Scn9a	UTSW	2	66501666	missense	probably damaging	1.00
R8822:Scn9a	UTSW	2	66540635	missense	probably damaging	0.99
R8829:Scn9a	UTSW	2	66483617	missense	probably benign
R9009:Scn9a	UTSW	2	66508583	missense	probably damaging	1.00
R9038:Scn9a	UTSW	2	66494803	missense	probably damaging	1.00
R9126:Scn9a	UTSW	2	66484400	missense	probably damaging	1.00
R9205:Scn9a	UTSW	2	66533313	missense	probably damaging	1.00
R9300:Scn9a	UTSW	2	66504892	missense	probably benign	0.39
R9373:Scn9a	UTSW	2	66483917	missense	probably benign	0.00
R9404:Scn9a	UTSW	2	66526696	missense	probably benign	0.02
R9443:Scn9a	UTSW	2	66565209	missense	probably damaging	1.00
R9590:Scn9a	UTSW	2	66483984	missense	probably benign	0.05
R9612:Scn9a	UTSW	2	66533364	missense	probably damaging	1.00
R9617:Scn9a	UTSW	2	66562465	missense	probably damaging	1.00
R9717:Scn9a	UTSW	2	66526658	missense	probably benign
X0003:Scn9a	UTSW	2	66508647	missense	probably benign	0.02
X0062:Scn9a	UTSW	2	66568077	missense	probably damaging	1.00
Z1176:Scn9a	UTSW	2	66540592	missense	probably benign	0.00
Z1177:Scn9a	UTSW	2	66494685	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ACGTAGGCAAAGTTGGACATCC -3'
(R):5'- GAAAGGAGTATGCCCATGAATTTAG -3'

Sequencing Primer
(F):5'- TCCCAAAGATGGCGTAGATG -3'
(R):5'- TGGTCCACAAGGTAAGTTCC -3'

Posted On

2019-12-20