Incidental Mutation 'R7864:C1s2'
ID607714
Institutional Source Beutler Lab
Gene Symbol C1s2
Ensembl Gene ENSMUSG00000079343
Gene Namecomplement component 1, s subcomponent 2
SynonymsGm5077
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124624625-124636085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124625287 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 655 (V655A)
Ref Sequence ENSEMBL: ENSMUSP00000151642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068797] [ENSMUST00000218020]
Predicted Effect probably benign
Transcript: ENSMUST00000068797
AA Change: V649A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000066999
Gene: ENSMUSG00000079343
AA Change: V649A

DomainStartEndE-ValueType
CUB 15 136 1.31e-28 SMART
EGF_CA 137 178 3.35e-7 SMART
CUB 181 296 1.45e-30 SMART
CCP 300 360 3.27e-6 SMART
CCP 365 427 9.54e-8 SMART
Tryp_SPc 443 681 8.92e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218020
AA Change: V655A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in C1s2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:C1s2 APN 6 124625653 missense probably damaging 0.99
IGL02112:C1s2 APN 6 124625308 missense probably benign 0.28
IGL02342:C1s2 APN 6 124632116 missense probably damaging 0.98
R0616:C1s2 UTSW 6 124628764 missense probably damaging 1.00
R0621:C1s2 UTSW 6 124631112 missense probably damaging 1.00
R1439:C1s2 UTSW 6 124630167 splice site probably benign
R1451:C1s2 UTSW 6 124625494 missense probably benign 0.06
R1484:C1s2 UTSW 6 124625645 missense possibly damaging 0.95
R1570:C1s2 UTSW 6 124625764 missense probably benign 0.01
R1824:C1s2 UTSW 6 124635682 missense probably benign 0.03
R2009:C1s2 UTSW 6 124635089 missense probably damaging 1.00
R2109:C1s2 UTSW 6 124635045 missense probably damaging 0.96
R2197:C1s2 UTSW 6 124632110 missense probably damaging 1.00
R4421:C1s2 UTSW 6 124625215 missense probably benign 0.39
R4573:C1s2 UTSW 6 124628243 intron probably null
R4906:C1s2 UTSW 6 124635114 nonsense probably null
R4923:C1s2 UTSW 6 124625690 missense probably benign 0.00
R4977:C1s2 UTSW 6 124635639 missense probably damaging 0.96
R5030:C1s2 UTSW 6 124635588 missense possibly damaging 0.77
R5690:C1s2 UTSW 6 124631037 missense probably benign 0.13
R5708:C1s2 UTSW 6 124625743 nonsense probably null
R5846:C1s2 UTSW 6 124631164 missense probably damaging 1.00
R6176:C1s2 UTSW 6 124625809 missense probably damaging 1.00
R6177:C1s2 UTSW 6 124630001 missense probably damaging 0.96
R6842:C1s2 UTSW 6 124627502 missense probably benign 0.12
R7291:C1s2 UTSW 6 124625384 missense probably benign 0.16
R7590:C1s2 UTSW 6 124632128 missense probably damaging 1.00
R7721:C1s2 UTSW 6 124630058 missense possibly damaging 0.73
R7886:C1s2 UTSW 6 124628330 missense possibly damaging 0.95
R7947:C1s2 UTSW 6 124625287 missense probably benign 0.18
R7969:C1s2 UTSW 6 124628330 missense possibly damaging 0.95
X0062:C1s2 UTSW 6 124635090 missense probably damaging 1.00
Z1177:C1s2 UTSW 6 124625734 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCATTGTTGTGAAATAAGGGGAC -3'
(R):5'- GCAAAGGTACCGGTAACCTC -3'

Sequencing Primer
(F):5'- CCACCATAGGATCTGAGAACAGTG -3'
(R):5'- GCAAAGGTACCGGTAACCTCTTTAG -3'
Posted On2019-12-20