Incidental Mutation 'R7864:Adam32'
ID607717
Institutional Source Beutler Lab
Gene Symbol Adam32
Ensembl Gene ENSMUSG00000037437
Gene Namea disintegrin and metallopeptidase domain 32
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score203.009
Status Not validated
Chromosome8
Chromosomal Location24836140-24948804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24922276 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 88 (H88L)
Ref Sequence ENSEMBL: ENSMUSP00000113627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119720] [ENSMUST00000121438]
Predicted Effect probably benign
Transcript: ENSMUST00000119720
AA Change: H88L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113076
Gene: ENSMUSG00000037437
AA Change: H88L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 145 4.5e-32 PFAM
Pfam:Reprolysin 187 384 4.1e-66 PFAM
Pfam:Reprolysin_3 211 318 6.2e-7 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121438
AA Change: H88L

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113627
Gene: ENSMUSG00000037437
AA Change: H88L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 145 8.4e-26 PFAM
Pfam:Reprolysin 187 384 1.3e-68 PFAM
DISIN 400 481 2.69e-16 SMART
ACR 482 622 6.83e-38 SMART
EGF 631 660 1.73e0 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 719 754 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000134680
Gene: ENSMUSG00000037437
AA Change: H83L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 19 141 4.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the disintegrin family of membrane-anchored proteins that play a role in diverse biological processes such as brain development, fertilization, tumor development and inflammation. The encoded protein undergoes proteolytic processing to generate a mature polypeptide comprised of an metalloprotease, disintegrin and epidermal growth factor-like domains. This gene was found to be expressed predominantly in the pachytene spermatocytes, where the processed protein is localized to the sperm surface. This gene is located in a cluster of other disintegrin and metallopeptidase family genes on chromosome 8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Adam32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Adam32 APN 8 24921354 missense probably damaging 1.00
IGL00793:Adam32 APN 8 24837830 splice site probably benign
IGL01317:Adam32 APN 8 24872581 missense probably damaging 1.00
IGL01475:Adam32 APN 8 24872648 missense probably damaging 1.00
IGL01501:Adam32 APN 8 24914353 missense probably damaging 1.00
IGL01659:Adam32 APN 8 24870774 splice site probably benign
IGL01994:Adam32 APN 8 24902796 splice site probably benign
IGL02137:Adam32 APN 8 24872594 missense probably damaging 1.00
IGL02393:Adam32 APN 8 24920053 missense probably damaging 1.00
IGL02516:Adam32 APN 8 24898596 missense probably damaging 1.00
IGL02892:Adam32 APN 8 24878711 intron probably benign
IGL02929:Adam32 APN 8 24872643 missense possibly damaging 0.81
IGL03273:Adam32 APN 8 24921340 missense probably damaging 1.00
PIT4515001:Adam32 UTSW 8 24914326 missense possibly damaging 0.88
R0088:Adam32 UTSW 8 24914067 missense probably damaging 1.00
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0098:Adam32 UTSW 8 24914389 missense possibly damaging 0.79
R0189:Adam32 UTSW 8 24922337 critical splice acceptor site probably null
R1740:Adam32 UTSW 8 24921298 missense probably damaging 1.00
R1853:Adam32 UTSW 8 24898626 missense probably benign 0.02
R2090:Adam32 UTSW 8 24901440 critical splice donor site probably null
R2906:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R2907:Adam32 UTSW 8 24863504 missense probably damaging 1.00
R4304:Adam32 UTSW 8 24901529 missense probably damaging 1.00
R4612:Adam32 UTSW 8 24872736 missense probably damaging 1.00
R4673:Adam32 UTSW 8 24884455 missense probably damaging 1.00
R4786:Adam32 UTSW 8 24863493 missense probably damaging 1.00
R5292:Adam32 UTSW 8 24864451 missense possibly damaging 0.85
R5398:Adam32 UTSW 8 24872579 missense possibly damaging 0.95
R5524:Adam32 UTSW 8 24922312 missense probably damaging 0.99
R5939:Adam32 UTSW 8 24914122 missense probably damaging 1.00
R6350:Adam32 UTSW 8 24863429 missense possibly damaging 0.86
R6766:Adam32 UTSW 8 24872630 missense probably damaging 0.96
R6893:Adam32 UTSW 8 24878754 missense probably damaging 1.00
R7095:Adam32 UTSW 8 24914070 missense probably damaging 1.00
R7241:Adam32 UTSW 8 24898494 missense probably benign 0.00
R7457:Adam32 UTSW 8 24884619 missense probably damaging 0.98
R7947:Adam32 UTSW 8 24922276 missense probably benign 0.11
Z1176:Adam32 UTSW 8 24948750 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAACATAACTCTGCCAAGATGTAGG -3'
(R):5'- ACCACCATGTCAAAAGTTGC -3'

Sequencing Primer
(F):5'- TGTAGGAGGCACTTCATGACC -3'
(R):5'- CTCTGTTGTTTCTTGAAGAGTA -3'
Posted On2019-12-20