Incidental Mutation 'R7864:Rab1a'
ID607729
Institutional Source Beutler Lab
Gene Symbol Rab1a
Ensembl Gene ENSMUSG00000020149
Gene NameRAB1A, member RAS oncogene family
SynonymsYpt1, Rab1, Rab-1, Gtbp, ras-related YPT1 protein
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location20201432-20226856 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 20215673 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 23 (G23*)
Ref Sequence ENSEMBL: ENSMUSP00000127330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020358] [ENSMUST00000109601] [ENSMUST00000109602] [ENSMUST00000163483]
Predicted Effect probably null
Transcript: ENSMUST00000020358
AA Change: G20*
SMART Domains Protein: ENSMUSP00000020358
Gene: ENSMUSG00000020149
AA Change: G20*

DomainStartEndE-ValueType
RAB 9 172 2.9e-107 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109601
AA Change: G20*
SMART Domains Protein: ENSMUSP00000105230
Gene: ENSMUSG00000020149
AA Change: G20*

DomainStartEndE-ValueType
Pfam:Ras 10 63 1.4e-18 PFAM
Pfam:Miro 10 93 8.4e-7 PFAM
Pfam:Ras 61 95 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109602
AA Change: G20*
SMART Domains Protein: ENSMUSP00000105231
Gene: ENSMUSG00000020149
AA Change: G20*

DomainStartEndE-ValueType
Pfam:Ras 10 31 7.6e-6 PFAM
Pfam:Ras 29 107 8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163483
AA Change: G23*
SMART Domains Protein: ENSMUSP00000127330
Gene: ENSMUSG00000020149
AA Change: G23*

DomainStartEndE-ValueType
RAB 12 175 2.9e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of GTPases. Members of the gene family cycle between inactive GDP-bound and active GTP-bound forms. This small GTPase controls vesicle traffic from the endoplasmic reticulum to the Golgi apparatus. Multiple alternatively spliced transcript variants have been identified for this gene which encode different protein isoforms. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Rab1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Rab1a APN 11 20224727 missense possibly damaging 0.92
IGL01639:Rab1a APN 11 20223185 splice site probably benign
IGL01982:Rab1a APN 11 20224717 missense probably benign 0.17
R0504:Rab1a UTSW 11 20223169 missense probably damaging 0.99
R1167:Rab1a UTSW 11 20223172 missense possibly damaging 0.93
R2967:Rab1a UTSW 11 20223068 intron probably null
R3703:Rab1a UTSW 11 20224506 splice site probably benign
R5623:Rab1a UTSW 11 20201626 utr 5 prime probably benign
R5897:Rab1a UTSW 11 20218867 nonsense probably null
R7947:Rab1a UTSW 11 20215673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGCGTGAGTCACATGTTC -3'
(R):5'- ATTTGGGAGCACTTAGGCAC -3'

Sequencing Primer
(F):5'- AGTCACATGTTCAGCTGTGTATC -3'
(R):5'- GGCACTTTGATATATAAACTCTGA -3'
Posted On2019-12-20