Incidental Mutation 'R7864:Rgs9'
ID607730
Institutional Source Beutler Lab
Gene Symbol Rgs9
Ensembl Gene ENSMUSG00000020599
Gene Nameregulator of G-protein signaling 9
SynonymsRgs9-2, RGS9-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location109225355-109298129 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109275620 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 108 (F108Y)
Ref Sequence ENSEMBL: ENSMUSP00000020920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020920] [ENSMUST00000106704] [ENSMUST00000106706]
PDB Structure
The multifunctional nature of Gbeta5/RGS9 revealed from its crystal structure [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020920
AA Change: F108Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020920
Gene: ENSMUSG00000020599
AA Change: F108Y

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
low complexity region 486 504 N/A INTRINSIC
low complexity region 562 574 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106704
AA Change: F108Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102315
Gene: ENSMUSG00000020599
AA Change: F108Y

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
Blast:G_gamma 154 229 4e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106706
AA Change: F108Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102317
Gene: ENSMUSG00000020599
AA Change: F108Y

DomainStartEndE-ValueType
DEP 30 105 2.2e-16 SMART
G_gamma 216 280 5.01e-17 SMART
GGL 219 280 5.55e-23 SMART
RGS 299 414 4.47e-48 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RGS family of GTPase activating proteins that function in various signaling pathways by accelerating the deactivation of G proteins. This protein is anchored to photoreceptor membranes in retinal cells and deactivates G proteins in the rod and cone phototransduction cascades. Mutations in this gene result in bradyopsia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, relative to wild-type, homozygous null photoreceptors display abnormally retarded recovery of their light responses, and slowed rates of GTP hydrolysis by transducin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Rgs9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Rgs9 APN 11 109249049 splice site probably benign
IGL01949:Rgs9 APN 11 109259834 critical splice donor site probably null
IGL02479:Rgs9 APN 11 109225652 missense possibly damaging 0.51
IGL03170:Rgs9 APN 11 109259855 missense probably benign 0.10
R1368:Rgs9 UTSW 11 109248151 missense probably benign 0.00
R1499:Rgs9 UTSW 11 109268921 critical splice donor site probably null
R1780:Rgs9 UTSW 11 109239499 nonsense probably null
R2422:Rgs9 UTSW 11 109225777 critical splice acceptor site probably null
R2509:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2510:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R2511:Rgs9 UTSW 11 109268972 missense probably benign 0.00
R3932:Rgs9 UTSW 11 109275813 splice site probably benign
R4179:Rgs9 UTSW 11 109281448 critical splice donor site probably null
R4801:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4802:Rgs9 UTSW 11 109240868 missense probably damaging 1.00
R4928:Rgs9 UTSW 11 109225744 missense probably benign 0.08
R5073:Rgs9 UTSW 11 109227331 missense probably benign 0.03
R5209:Rgs9 UTSW 11 109239594 critical splice acceptor site probably null
R5286:Rgs9 UTSW 11 109239451 splice site probably null
R5449:Rgs9 UTSW 11 109225744 missense probably benign
R6046:Rgs9 UTSW 11 109239560 missense probably damaging 1.00
R6267:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R6296:Rgs9 UTSW 11 109268987 missense probably benign 0.01
R7325:Rgs9 UTSW 11 109276581 missense probably damaging 1.00
R7453:Rgs9 UTSW 11 109227268 missense probably damaging 1.00
R7947:Rgs9 UTSW 11 109275620 missense probably damaging 1.00
R8035:Rgs9 UTSW 11 109273324 missense probably benign 0.28
Z1177:Rgs9 UTSW 11 109239592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTCCAATACAGATGTGAGC -3'
(R):5'- ATCTCATCCTCAAGCCGGAC -3'

Sequencing Primer
(F):5'- CTCCAATACAGATGTGAGCTGACG -3'
(R):5'- GGACAGCAGTCTCTACCGATTTCAG -3'
Posted On2019-12-20