Incidental Mutation 'R7864:Acot2'
ID607732
Institutional Source Beutler Lab
Gene Symbol Acot2
Ensembl Gene ENSMUSG00000021226
Gene Nameacyl-CoA thioesterase 2
SynonymsMTE-I, Mte1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location83987861-83993873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83988022 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 41 (R41W)
Ref Sequence ENSEMBL: ENSMUSP00000021649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021649] [ENSMUST00000164935]
Predicted Effect probably benign
Transcript: ENSMUST00000021649
AA Change: R41W

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021649
Gene: ENSMUSG00000021226
AA Change: R41W

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 57 182 3e-45 PFAM
low complexity region 189 202 N/A INTRINSIC
Pfam:BAAT_C 244 451 7.6e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164935
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Acot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0417:Acot2 UTSW 12 83990613 missense probably benign 0.36
R1101:Acot2 UTSW 12 83992850 missense probably benign 0.22
R1609:Acot2 UTSW 12 83992856 missense possibly damaging 0.93
R2267:Acot2 UTSW 12 83990560 missense probably damaging 1.00
R6166:Acot2 UTSW 12 83992604 missense probably damaging 1.00
R7384:Acot2 UTSW 12 83992667 missense probably benign
R7655:Acot2 UTSW 12 83992917 missense probably benign 0.05
R7656:Acot2 UTSW 12 83992917 missense probably benign 0.05
R7682:Acot2 UTSW 12 83987924 missense probably benign 0.01
R7796:Acot2 UTSW 12 83988483 critical splice donor site probably null
R7845:Acot2 UTSW 12 83992988 nonsense probably null
X0021:Acot2 UTSW 12 83988085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGGATCTCTTAACTTTCTCTGCGG -3'
(R):5'- AAGAAGTGACGCTCGTGCAC -3'

Sequencing Primer
(F):5'- TAACTTTCTCTGCGGAACCGAGG -3'
(R):5'- ACGTCGCGCTTGATCAG -3'
Posted On2019-12-20