Incidental Mutation 'R7864:Pld4'
ID607734
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112765123 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 237 (Q237K)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888]
Predicted Effect probably damaging
Transcript: ENSMUST00000063888
AA Change: Q237K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: Q237K

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6767:Pld4 UTSW 12 112764115 missense possibly damaging 0.51
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7947:Pld4 UTSW 12 112765123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGGGCAGATCTATTAGG -3'
(R):5'- GGTGGGACCAACTCTGATTG -3'

Sequencing Primer
(F):5'- GTTAGCATTAAAGAGCTGGCTC -3'
(R):5'- AACTCTGATTGGCCCTGCTATGG -3'
Posted On2019-12-20