Incidental Mutation 'R7864:Slc28a3'
ID607737
Institutional Source Beutler Lab
Gene Symbol Slc28a3
Ensembl Gene ENSMUSG00000021553
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 3
SynonymsCnt3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location58545399-58610877 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 58578403 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022036] [ENSMUST00000148396]
Predicted Effect probably null
Transcript: ENSMUST00000022036
SMART Domains Protein: ENSMUSP00000022036
Gene: ENSMUSG00000021553

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 146 163 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Pfam:Nucleos_tra2_N 221 292 3.5e-27 PFAM
Pfam:Gate 300 401 4.9e-11 PFAM
Pfam:Nucleos_tra2_C 403 627 4.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148396
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside transporters, such as SLC28A3, regulate multiple cellular processes, including neurotransmission, vascular tone, adenosine concentration in the vicinity of cell surface receptors, and transport and metabolism of nucleoside drugs. SLC28A3 shows broad specificity for pyrimidine and purine nucleosides (Ritzel et al., 2001 [PubMed 11032837]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Slc28a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc28a3 APN 13 58574300 missense probably benign 0.05
IGL00432:Slc28a3 APN 13 58569411 splice site probably null
IGL00553:Slc28a3 APN 13 58563009 splice site probably null
IGL01725:Slc28a3 APN 13 58578510 missense probably benign 0.30
IGL02068:Slc28a3 APN 13 58558597 missense probably damaging 1.00
IGL02270:Slc28a3 APN 13 58580584 missense probably benign 0.00
IGL02271:Slc28a3 APN 13 58558637 missense probably benign 0.21
IGL02373:Slc28a3 APN 13 58578404 critical splice donor site probably null
IGL02542:Slc28a3 APN 13 58573470 missense probably damaging 1.00
IGL03242:Slc28a3 APN 13 58574249 nonsense probably null
R0256:Slc28a3 UTSW 13 58573500 missense probably benign
R0323:Slc28a3 UTSW 13 58564052 nonsense probably null
R0391:Slc28a3 UTSW 13 58569415 splice site probably benign
R0838:Slc28a3 UTSW 13 58588269 missense probably benign 0.00
R1433:Slc28a3 UTSW 13 58563106 missense probably damaging 1.00
R1437:Slc28a3 UTSW 13 58558575 nonsense probably null
R3499:Slc28a3 UTSW 13 58573439 splice site probably benign
R3822:Slc28a3 UTSW 13 58558278 missense probably benign 0.00
R3948:Slc28a3 UTSW 13 58563010 splice site probably null
R4011:Slc28a3 UTSW 13 58566250 missense probably benign 0.06
R4028:Slc28a3 UTSW 13 58610756 missense probably benign 0.27
R4073:Slc28a3 UTSW 13 58559290 missense probably benign 0.01
R4745:Slc28a3 UTSW 13 58574263 missense possibly damaging 0.69
R4939:Slc28a3 UTSW 13 58558581 missense probably benign 0.44
R5416:Slc28a3 UTSW 13 58576793 missense probably damaging 0.99
R5421:Slc28a3 UTSW 13 58574265 missense possibly damaging 0.87
R5426:Slc28a3 UTSW 13 58563154 missense probably damaging 1.00
R5688:Slc28a3 UTSW 13 58558649 missense probably damaging 0.96
R6066:Slc28a3 UTSW 13 58578487 missense probably benign 0.00
R6790:Slc28a3 UTSW 13 58582650 missense probably benign 0.00
R6919:Slc28a3 UTSW 13 58573443 critical splice donor site probably null
R7009:Slc28a3 UTSW 13 58610804 missense probably benign 0.28
R7102:Slc28a3 UTSW 13 58588214 missense probably benign 0.04
R7305:Slc28a3 UTSW 13 58566231 missense possibly damaging 0.65
R7307:Slc28a3 UTSW 13 58563172 missense probably damaging 1.00
R7464:Slc28a3 UTSW 13 58563021 nonsense probably null
R7947:Slc28a3 UTSW 13 58578403 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGACTTTTACCAGCACCTC -3'
(R):5'- CAGCCTGTGCGATAAACTTC -3'

Sequencing Primer
(F):5'- TTTTACCAGCACCTCAGATAAGGGG -3'
(R):5'- TGTGCGATAAACTTCCACAGAG -3'
Posted On2019-12-20