Incidental Mutation 'R7864:Htr1f'
ID607745
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 64926794 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 45 (I45S)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect probably damaging
Transcript: ENSMUST00000063076
AA Change: I45S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: I45S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R0722:Htr1f UTSW 16 64925891 missense probably damaging 0.99
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7947:Htr1f UTSW 16 64926794 missense probably damaging 1.00
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCGACACTCAGCCAAATGTC -3'
(R):5'- GCACGATACTTGAAACTTTCTCTG -3'

Sequencing Primer
(F):5'- GCCAAATGTCACAGAGTACTTGTC -3'
(R):5'- GAAACTTTCTCTGAACTATGTTTCCC -3'
Posted On2019-12-20