Incidental Mutation 'R7864:Arid1b'
ID607747
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5342255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1967 (L1967P)
Ref Sequence ENSEMBL: ENSMUSP00000090398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably damaging
Transcript: ENSMUST00000092723
AA Change: L1967P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: L1967P

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115797
AA Change: L1968P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: L1968P

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115799
AA Change: L1486P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: L1486P

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232180
AA Change: L2020P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5290979 missense probably damaging 1.00
R7270:Arid1b UTSW 17 4996043 missense unknown
R7514:Arid1b UTSW 17 5341714 missense probably benign 0.28
R7519:Arid1b UTSW 17 4995844 small insertion probably benign
R7519:Arid1b UTSW 17 4995853 small insertion probably benign
R7521:Arid1b UTSW 17 4995844 small insertion probably benign
R7521:Arid1b UTSW 17 4995860 small insertion probably benign
R7521:Arid1b UTSW 17 5342590 missense probably benign 0.06
R7616:Arid1b UTSW 17 4995386 missense unknown
R7654:Arid1b UTSW 17 5291085 missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5336820 missense probably benign 0.28
R7828:Arid1b UTSW 17 5097668 missense probably damaging 1.00
R7947:Arid1b UTSW 17 5342255 missense probably damaging 1.00
R7998:Arid1b UTSW 17 5327684 missense probably damaging 1.00
RF007:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995595 small insertion probably benign
RF025:Arid1b UTSW 17 4995588 small insertion probably benign
RF025:Arid1b UTSW 17 4995596 small insertion probably benign
RF028:Arid1b UTSW 17 4995598 small insertion probably benign
RF032:Arid1b UTSW 17 4995588 small insertion probably benign
RF033:Arid1b UTSW 17 4995585 small insertion probably benign
RF041:Arid1b UTSW 17 4995595 small insertion probably benign
RF045:Arid1b UTSW 17 4995583 small insertion probably benign
RF046:Arid1b UTSW 17 4995590 small insertion probably benign
RF058:Arid1b UTSW 17 4995583 small insertion probably benign
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Z1177:Arid1b UTSW 17 4996328 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CAGCGGCAAGTTTCCCTTTG -3'
(R):5'- GGAAATGTTCGCCAACGTGAC -3'

Sequencing Primer
(F):5'- TCCCTTTGGAATCCAGCAGG -3'
(R):5'- AACGTGACCAGGGTGTTATCC -3'
Posted On2019-12-20