Mutagenetix > Incidental Mutation

Incidental Mutation 'R7864:Arid1b'

607747

Institutional Source

Beutler Lab

Gene Symbol

Arid1b

Ensembl Gene

ENSMUSG00000069729

Gene Name

AT rich interactive domain 1B (SWI-like)

Synonyms

B230217J03Rik, 9330189K18Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Essential gene?

Possibly essential (E-score: 0.713) question?

Stock #

R7864 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4994332-5347656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5342255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1967 (L1967P)

Ref Sequence

ENSEMBL: ENSMUSP00000090398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]

AlphaFold

E9Q4N7

Predicted Effect

probably damaging
Transcript: ENSMUST00000092723
AA Change: L1967P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: L1967P

Domain	Start	End	E-Value	Type
low complexity region	2	51	N/A	INTRINSIC
low complexity region	69	132	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	201	224	N/A	INTRINSIC
low complexity region	232	247	N/A	INTRINSIC
low complexity region	257	276	N/A	INTRINSIC
low complexity region	301	371	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	438	476	N/A	INTRINSIC
low complexity region	485	499	N/A	INTRINSIC
low complexity region	538	558	N/A	INTRINSIC
low complexity region	574	591	N/A	INTRINSIC
low complexity region	596	611	N/A	INTRINSIC
low complexity region	615	640	N/A	INTRINSIC
low complexity region	691	707	N/A	INTRINSIC
low complexity region	719	740	N/A	INTRINSIC
low complexity region	743	773	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	912	930	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	974	985	N/A	INTRINSIC
low complexity region	1036	1045	N/A	INTRINSIC
ARID	1057	1147	9.9e-33	SMART
BRIGHT	1061	1152	7.62e-41	SMART
low complexity region	1166	1177	N/A	INTRINSIC
low complexity region	1257	1268	N/A	INTRINSIC
low complexity region	1336	1364	N/A	INTRINSIC
low complexity region	1426	1456	N/A	INTRINSIC
low complexity region	1473	1486	N/A	INTRINSIC
low complexity region	1579	1595	N/A	INTRINSIC
coiled coil region	1724	1745	N/A	INTRINSIC
low complexity region	1835	1843	N/A	INTRINSIC
Pfam:DUF3518	1933	2189	1.5e-152	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115797
AA Change: L1968P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: L1968P

Domain	Start	End	E-Value	Type
low complexity region	17	80	N/A	INTRINSIC
low complexity region	87	98	N/A	INTRINSIC
low complexity region	149	172	N/A	INTRINSIC
low complexity region	180	195	N/A	INTRINSIC
low complexity region	205	224	N/A	INTRINSIC
low complexity region	249	319	N/A	INTRINSIC
low complexity region	327	355	N/A	INTRINSIC
low complexity region	386	424	N/A	INTRINSIC
low complexity region	433	447	N/A	INTRINSIC
low complexity region	486	506	N/A	INTRINSIC
low complexity region	522	539	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
low complexity region	563	588	N/A	INTRINSIC
low complexity region	639	655	N/A	INTRINSIC
low complexity region	667	688	N/A	INTRINSIC
low complexity region	691	721	N/A	INTRINSIC
low complexity region	753	764	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	884	900	N/A	INTRINSIC
low complexity region	922	933	N/A	INTRINSIC
Blast:ARID	981	1028	1e-8	BLAST
low complexity region	1029	1054	N/A	INTRINSIC
ARID	1058	1148	9.9e-33	SMART
BRIGHT	1062	1153	7.62e-41	SMART
low complexity region	1167	1178	N/A	INTRINSIC
low complexity region	1258	1269	N/A	INTRINSIC
low complexity region	1337	1365	N/A	INTRINSIC
low complexity region	1427	1457	N/A	INTRINSIC
low complexity region	1474	1487	N/A	INTRINSIC
low complexity region	1580	1596	N/A	INTRINSIC
coiled coil region	1725	1746	N/A	INTRINSIC
low complexity region	1836	1844	N/A	INTRINSIC
Pfam:DUF3518	1935	2190	6.3e-121	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115799
AA Change: L1486P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: L1486P

Domain	Start	End	E-Value	Type
low complexity region	34	54	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	92	107	N/A	INTRINSIC
low complexity region	111	136	N/A	INTRINSIC
low complexity region	187	203	N/A	INTRINSIC
low complexity region	215	236	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	402	418	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
Blast:ARID	499	546	1e-8	BLAST
low complexity region	547	572	N/A	INTRINSIC
ARID	576	666	9.9e-33	SMART
BRIGHT	580	671	7.62e-41	SMART
low complexity region	685	696	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	855	883	N/A	INTRINSIC
low complexity region	945	975	N/A	INTRINSIC
low complexity region	992	1005	N/A	INTRINSIC
low complexity region	1098	1114	N/A	INTRINSIC
coiled coil region	1243	1264	N/A	INTRINSIC
low complexity region	1354	1362	N/A	INTRINSIC
Pfam:DUF3518	1452	1708	1.1e-152	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000232180
AA Change: L2020P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	C	T	12: 83,988,022	R41W	probably benign	Het
Adam32	T	A	8: 24,922,276	H88L	probably benign	Het
Ank1	A	G	8: 23,087,960	T238A	probably damaging	Het
Bbx	G	T	16: 50,262,434	H216Q	probably damaging	Het
C030005K15Rik	G	A	10: 97,725,752	T39M	probably damaging	Het
C1s2	A	G	6: 124,625,287	V655A	probably benign	Het
Carmil2	A	G	8: 105,688,274	Y184C	probably damaging	Het
Ces1f	G	A	8: 93,274,141	A125V	possibly damaging	Het
Chaf1a	C	T	17: 56,047,339	T203I	unknown	Het
Cntn5	A	G	9: 9,984,177	S144P	probably damaging	Het
Cpa5	A	T	6: 30,631,395	Y436F	probably damaging	Het
Dbf4	A	T	5: 8,410,010	H150Q	possibly damaging	Het
Dlg5	G	A	14: 24,245,212	P80L	probably damaging	Het
Dock8	A	T	19: 25,163,500	D1360V	possibly damaging	Het
Ecm1	A	T	3: 95,734,376	I515N	probably benign	Het
Fancc	A	T	13: 63,400,259	C75*	probably null	Het
Foxa1	A	T	12: 57,542,747	V229D	probably damaging	Het
Gga1	T	C	15: 78,888,244	M248T	probably damaging	Het
Gm1527	A	G	3: 28,926,470	Q573R	probably benign	Het
Gm5615	A	T	9: 36,534,451	F68Y	probably benign	Het
Hivep1	A	C	13: 42,158,814	H1510P	probably benign	Het
Htr1f	A	C	16: 64,926,794	I45S	probably damaging	Het
Itsn1	T	C	16: 91,801,566	V129A	possibly damaging	Het
Klrg2	G	T	6: 38,628,089	Q347K	possibly damaging	Het
Lama2	G	A	10: 27,056,615	T1996I	probably benign	Het
Man1a	C	A	10: 54,030,747	L219F	possibly damaging	Het
Mcub	A	G	3: 129,918,623	I201T	probably damaging	Het
Olfr1494	A	G	19: 13,749,346	D80G	probably benign	Het
Otogl	A	G	10: 107,869,567	L633P	probably damaging	Het
Pik3ca	T	A	3: 32,443,613	L429*	probably null	Het
Pkhd1l1	T	C	15: 44,526,053		probably null	Het
Pld4	C	A	12: 112,765,123	Q237K	probably damaging	Het
Plekhm2	T	C	4: 141,628,046	E897G	probably damaging	Het
Pomt2	A	G	12: 87,122,882	F475L	probably benign	Het
Popdc3	G	A	10: 45,315,182	A130T	probably benign	Het
Prss54	T	C	8: 95,559,669	K259E	probably benign	Het
Psg23	T	G	7: 18,610,510	N340T	possibly damaging	Het
Rab1a	G	T	11: 20,215,673	G23*	probably null	Het
Rgs9	A	T	11: 109,275,620	F108Y	probably damaging	Het
Scn9a	T	A	2: 66,484,560	T1605S	possibly damaging	Het
Sh2d4b	G	A	14: 40,840,251	T319I	probably damaging	Het
Slc28a3	A	T	13: 58,578,403		probably null	Het
Syngap1	A	T	17: 26,970,528	Q1286L		Het
Tmem132d	G	A	5: 127,783,916	T1047I	probably damaging	Het
Togaram2	G	A	17: 71,700,940	R420H	probably damaging	Het
Uimc1	G	A	13: 55,093,267	R3*	probably null	Het
Vmn2r7	C	T	3: 64,691,526	V537I	probably benign	Het
Wwp1	T	A	4: 19,635,328	K584N	probably damaging	Het
Zc3h12d	A	T	10: 7,839,959	Q42L	possibly damaging	Het
Zfp729a	A	T	13: 67,621,450	V220E	probably benign	Het
Zfp91	A	G	19: 12,771,039	V391A	probably damaging	Het

Other mutations in Arid1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Arid1b	APN	17	5337110	missense	possibly damaging	0.77
IGL00340:Arid1b	APN	17	5321284	missense	probably damaging	1.00
IGL00886:Arid1b	APN	17	5126979	missense	probably damaging	0.99
IGL01161:Arid1b	APN	17	5342399	missense	probably damaging	1.00
IGL01391:Arid1b	APN	17	5318858	splice site	probably benign
IGL01456:Arid1b	APN	17	5291235	missense	probably damaging	1.00
IGL02152:Arid1b	APN	17	5313968	missense	probably damaging	1.00
IGL02288:Arid1b	APN	17	5264040	missense	possibly damaging	0.88
IGL02713:Arid1b	APN	17	5343011	missense	probably damaging	1.00
IGL02858:Arid1b	APN	17	5341891	missense	possibly damaging	0.92
IGL02885:Arid1b	APN	17	5342153	missense	probably damaging	1.00
IGL02989:Arid1b	APN	17	5335047	missense	probably damaging	1.00
FR4449:Arid1b	UTSW	17	4995589	small insertion	probably benign
PIT4142001:Arid1b	UTSW	17	5339243	missense	probably damaging	1.00
R0048:Arid1b	UTSW	17	5314034	critical splice donor site	probably null
R0124:Arid1b	UTSW	17	5339330	missense	probably damaging	1.00
R0153:Arid1b	UTSW	17	5342932	missense	probably damaging	1.00
R0465:Arid1b	UTSW	17	4996260	missense	possibly damaging	0.68
R0825:Arid1b	UTSW	17	5342178	missense	probably damaging	1.00
R1172:Arid1b	UTSW	17	5339300	missense	probably damaging	1.00
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1616:Arid1b	UTSW	17	5339294	missense	probably damaging	1.00
R1754:Arid1b	UTSW	17	5279201	critical splice acceptor site	probably null
R1760:Arid1b	UTSW	17	5341813	missense	probably damaging	0.97
R1812:Arid1b	UTSW	17	5337029	missense	probably benign	0.10
R1911:Arid1b	UTSW	17	5342966	missense	probably damaging	1.00
R3874:Arid1b	UTSW	17	5336515	splice site	probably null
R3913:Arid1b	UTSW	17	5342257	missense	possibly damaging	0.94
R3916:Arid1b	UTSW	17	5342653	missense	probably benign	0.25
R3922:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R4119:Arid1b	UTSW	17	4995794	unclassified	probably benign
R4290:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4291:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4352:Arid1b	UTSW	17	5097584	missense	possibly damaging	0.93
R4386:Arid1b	UTSW	17	4994972	unclassified	probably benign
R4458:Arid1b	UTSW	17	5242916	missense	probably damaging	0.99
R4524:Arid1b	UTSW	17	5097620	missense	possibly damaging	0.93
R4622:Arid1b	UTSW	17	4995050	unclassified	probably benign
R4723:Arid1b	UTSW	17	5337290	missense	probably benign	0.01
R4782:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4799:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4910:Arid1b	UTSW	17	5342203	missense	probably damaging	1.00
R4946:Arid1b	UTSW	17	5342843	missense	probably damaging	0.99
R5083:Arid1b	UTSW	17	5314018	missense	possibly damaging	0.54
R5204:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R5347:Arid1b	UTSW	17	5291057	nonsense	probably null
R5553:Arid1b	UTSW	17	5313877	missense	probably damaging	1.00
R5713:Arid1b	UTSW	17	5336816	missense	probably damaging	1.00
R5820:Arid1b	UTSW	17	4996254	missense	possibly damaging	0.96
R5992:Arid1b	UTSW	17	4994956	unclassified	probably benign
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6153:Arid1b	UTSW	17	5242832	missense	probably damaging	1.00
R6222:Arid1b	UTSW	17	5327647	critical splice acceptor site	probably null
R6249:Arid1b	UTSW	17	5279361	missense	possibly damaging	0.61
R6279:Arid1b	UTSW	17	5341999	missense	probably damaging	1.00
R6329:Arid1b	UTSW	17	5337263	nonsense	probably null
R6368:Arid1b	UTSW	17	5332533	missense	possibly damaging	0.64
R6466:Arid1b	UTSW	17	5327678	missense	probably damaging	1.00
R6861:Arid1b	UTSW	17	5327686	missense	possibly damaging	0.93
R7008:Arid1b	UTSW	17	5290979	missense	probably damaging	1.00
R7270:Arid1b	UTSW	17	4996043	missense	unknown
R7514:Arid1b	UTSW	17	5341714	missense	probably benign	0.28
R7519:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7519:Arid1b	UTSW	17	4995853	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995860	small insertion	probably benign
R7521:Arid1b	UTSW	17	5342590	missense	probably benign	0.06
R7616:Arid1b	UTSW	17	4995386	missense	unknown
R7654:Arid1b	UTSW	17	5291085	missense	possibly damaging	0.46
R7711:Arid1b	UTSW	17	5336820	missense	probably benign	0.28
R7828:Arid1b	UTSW	17	5097668	missense	probably damaging	1.00
R7998:Arid1b	UTSW	17	5327684	missense	probably damaging	1.00
R8105:Arid1b	UTSW	17	5291243	missense	possibly damaging	0.81
R8260:Arid1b	UTSW	17	5332513	missense	probably benign	0.03
R8374:Arid1b	UTSW	17	5342644	missense	possibly damaging	0.95
R8779:Arid1b	UTSW	17	5341534	missense	probably benign	0.03
R8801:Arid1b	UTSW	17	5336828	missense	probably benign	0.05
R8894:Arid1b	UTSW	17	5327393	missense	probably damaging	0.98
R8982:Arid1b	UTSW	17	5243041	missense	probably damaging	0.98
R9034:Arid1b	UTSW	17	5336905	missense	probably benign	0.01
R9272:Arid1b	UTSW	17	5336604	missense	possibly damaging	0.80
R9300:Arid1b	UTSW	17	5242999	missense	probably damaging	1.00
R9332:Arid1b	UTSW	17	4995309	missense	unknown
R9481:Arid1b	UTSW	17	5318732	missense	probably damaging	1.00
R9493:Arid1b	UTSW	17	4996148	missense	unknown
R9512:Arid1b	UTSW	17	5341589	missense	probably benign	0.00
R9548:Arid1b	UTSW	17	5334987	missense	probably damaging	1.00
RF007:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995596	small insertion	probably benign
RF028:Arid1b	UTSW	17	4995598	small insertion	probably benign
RF032:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF033:Arid1b	UTSW	17	4995585	small insertion	probably benign
RF041:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF045:Arid1b	UTSW	17	4995583	small insertion	probably benign
RF046:Arid1b	UTSW	17	4995590	small insertion	probably benign
RF058:Arid1b	UTSW	17	4995583	small insertion	probably benign
X0023:Arid1b	UTSW	17	5342393	missense	probably benign	0.39
X0027:Arid1b	UTSW	17	5342372	nonsense	probably null
Z1177:Arid1b	UTSW	17	4996328	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CAGCGGCAAGTTTCCCTTTG -3'
(R):5'- GGAAATGTTCGCCAACGTGAC -3'

Sequencing Primer
(F):5'- TCCCTTTGGAATCCAGCAGG -3'
(R):5'- AACGTGACCAGGGTGTTATCC -3'

Posted On

2019-12-20