Incidental Mutation 'R7864:Syngap1'
ID607748
Institutional Source Beutler Lab
Gene Symbol Syngap1
Ensembl Gene ENSMUSG00000067629
Gene Namesynaptic Ras GTPase activating protein 1 homolog (rat)
SynonymsSyngap
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7864 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location26941253-26972434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26970528 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1286 (Q1286L)
Ref Sequence ENSEMBL: ENSMUSP00000144248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081285] [ENSMUST00000120016] [ENSMUST00000133257] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000228963] [ENSMUST00000229490] [ENSMUST00000231853]
Predicted Effect silent
Transcript: ENSMUST00000081285
SMART Domains Protein: ENSMUSP00000080038
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120016
SMART Domains Protein: ENSMUSP00000112778
Gene: ENSMUSG00000079605

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
BTB 48 142 4.08e-21 SMART
low complexity region 144 164 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
ZnF_C2H2 397 419 1.36e-2 SMART
ZnF_C2H2 424 444 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133257
SMART Domains Protein: ENSMUSP00000115777
Gene: ENSMUSG00000048731

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
internal_repeat_1 264 280 1.14e-6 PROSPERO
Pfam:Ubiquitin_3 281 368 1.5e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000177932
AA Change: Q1305L
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629
AA Change: Q1305L

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201186
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629
AA Change: Q1286L

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202049
Predicted Effect probably benign
Transcript: ENSMUST00000202208
Predicted Effect unknown
Transcript: ENSMUST00000228963
AA Change: Q1243L
Predicted Effect probably benign
Transcript: ENSMUST00000229490
AA Change: Q1302L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect silent
Transcript: ENSMUST00000231853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Homozygous null mutations result in early post-embryonic lethality, while heterozygous mutant mice display a variety of phenotypes that include learning and memory defects, hyperactivity, and audiogenic seizures. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, and by P3-P4, exhibit small body size and brain, reduced movement and do not feed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Zfp91 A G 19: 12,771,039 V391A probably damaging Het
Other mutations in Syngap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0732:Syngap1 UTSW 17 26954988 missense possibly damaging 0.94
R1178:Syngap1 UTSW 17 26957805 missense probably damaging 0.99
R1680:Syngap1 UTSW 17 26952579 missense possibly damaging 0.60
R1953:Syngap1 UTSW 17 26944687 missense possibly damaging 0.94
R2213:Syngap1 UTSW 17 26953069 missense probably damaging 1.00
R2696:Syngap1 UTSW 17 26957411 nonsense probably null
R2899:Syngap1 UTSW 17 26959985 missense probably damaging 1.00
R3237:Syngap1 UTSW 17 26957093 nonsense probably null
R3705:Syngap1 UTSW 17 26960020 missense probably damaging 1.00
R3880:Syngap1 UTSW 17 26953064 missense probably damaging 1.00
R4019:Syngap1 UTSW 17 26952341 unclassified probably benign
R4661:Syngap1 UTSW 17 26966906 missense probably damaging 1.00
R4798:Syngap1 UTSW 17 26961449 missense probably benign 0.00
R5524:Syngap1 UTSW 17 26957152 missense probably damaging 1.00
R5580:Syngap1 UTSW 17 26962331 missense probably damaging 0.97
R5610:Syngap1 UTSW 17 26959780 missense possibly damaging 0.68
R5835:Syngap1 UTSW 17 26958218 missense probably benign 0.09
R5974:Syngap1 UTSW 17 26963038 missense probably damaging 0.98
R6235:Syngap1 UTSW 17 26958130 missense probably benign 0.00
R6247:Syngap1 UTSW 17 26962957 nonsense probably null
R6461:Syngap1 UTSW 17 26964848 missense probably damaging 1.00
R6503:Syngap1 UTSW 17 26944684 missense probably benign 0.40
R7134:Syngap1 UTSW 17 26960011 missense probably damaging 1.00
R7248:Syngap1 UTSW 17 26957767 missense probably damaging 1.00
R7298:Syngap1 UTSW 17 26962987 missense possibly damaging 0.85
R7749:Syngap1 UTSW 17 26959964 missense probably damaging 0.99
R7812:Syngap1 UTSW 17 26941504 missense probably benign
R7947:Syngap1 UTSW 17 26970528 missense
R7966:Syngap1 UTSW 17 26961477 small deletion probably benign
R8024:Syngap1 UTSW 17 26941452 start codon destroyed probably benign 0.01
X0017:Syngap1 UTSW 17 26944651 missense probably benign 0.11
Z1088:Syngap1 UTSW 17 26961576 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTTCCTGGAGGTGAGAAAC -3'
(R):5'- TGCCCCAAGGAGGCATTAAG -3'

Sequencing Primer
(F):5'- TTTCCTGGAGGTGAGAAACAAACAG -3'
(R):5'- GGAGACAATCCCGCTGTC -3'
Posted On2019-12-20