Incidental Mutation 'R7864:Zfp91'
ID607751
Institutional Source Beutler Lab
Gene Symbol Zfp91
Ensembl Gene ENSMUSG00000024695
Gene Namezinc finger protein 91
SynonymsPzf, 9130014I08Rik, A530054C17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.469) question?
Stock #R7864 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location12763660-12796126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12771039 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 391 (V391A)
Ref Sequence ENSEMBL: ENSMUSP00000037971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038627] [ENSMUST00000142247]
Predicted Effect probably damaging
Transcript: ENSMUST00000038627
AA Change: V391A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037971
Gene: ENSMUSG00000024695
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142247
AA Change: V391A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124424
Gene: ENSMUSG00000024695
AA Change: V391A

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the zinc finger family of proteins. The gene product contains C2H2-type domains, which are the classical zinc finger domains found in numerous nucleic acid-binding proteins. The homologous human protein has been shown to function as a regulator of the non-canonical NF-kappaB pathway in lymphotoxin-beta receptor signaling. A read-through transcript variant composed of Zfp91 and the downstream Cntf gene sequence has been identified, but it is thought to be non-coding. Read-through transcription of Zfp91 and Cntf has been observed in both human and mouse. A Zfp91-related pseudogene has also been identified on chromosome 17. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,988,022 R41W probably benign Het
Adam32 T A 8: 24,922,276 H88L probably benign Het
Ank1 A G 8: 23,087,960 T238A probably damaging Het
Arid1b T C 17: 5,342,255 L1967P probably damaging Het
Bbx G T 16: 50,262,434 H216Q probably damaging Het
C030005K15Rik G A 10: 97,725,752 T39M probably damaging Het
C1s2 A G 6: 124,625,287 V655A probably benign Het
Carmil2 A G 8: 105,688,274 Y184C probably damaging Het
Ces1f G A 8: 93,274,141 A125V possibly damaging Het
Chaf1a C T 17: 56,047,339 T203I unknown Het
Cntn5 A G 9: 9,984,177 S144P probably damaging Het
Cpa5 A T 6: 30,631,395 Y436F probably damaging Het
Dbf4 A T 5: 8,410,010 H150Q possibly damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dock8 A T 19: 25,163,500 D1360V possibly damaging Het
Ecm1 A T 3: 95,734,376 I515N probably benign Het
Fancc A T 13: 63,400,259 C75* probably null Het
Foxa1 A T 12: 57,542,747 V229D probably damaging Het
Gga1 T C 15: 78,888,244 M248T probably damaging Het
Gm1527 A G 3: 28,926,470 Q573R probably benign Het
Gm5615 A T 9: 36,534,451 F68Y probably benign Het
Hivep1 A C 13: 42,158,814 H1510P probably benign Het
Htr1f A C 16: 64,926,794 I45S probably damaging Het
Itsn1 T C 16: 91,801,566 V129A possibly damaging Het
Klrg2 G T 6: 38,628,089 Q347K possibly damaging Het
Lama2 G A 10: 27,056,615 T1996I probably benign Het
Man1a C A 10: 54,030,747 L219F possibly damaging Het
Mcub A G 3: 129,918,623 I201T probably damaging Het
Olfr1494 A G 19: 13,749,346 D80G probably benign Het
Otogl A G 10: 107,869,567 L633P probably damaging Het
Pik3ca T A 3: 32,443,613 L429* probably null Het
Pkhd1l1 T C 15: 44,526,053 probably null Het
Pld4 C A 12: 112,765,123 Q237K probably damaging Het
Plekhm2 T C 4: 141,628,046 E897G probably damaging Het
Pomt2 A G 12: 87,122,882 F475L probably benign Het
Popdc3 G A 10: 45,315,182 A130T probably benign Het
Prss54 T C 8: 95,559,669 K259E probably benign Het
Psg23 T G 7: 18,610,510 N340T possibly damaging Het
Rab1a G T 11: 20,215,673 G23* probably null Het
Rgs9 A T 11: 109,275,620 F108Y probably damaging Het
Scn9a T A 2: 66,484,560 T1605S possibly damaging Het
Sh2d4b G A 14: 40,840,251 T319I probably damaging Het
Slc28a3 A T 13: 58,578,403 probably null Het
Syngap1 A T 17: 26,970,528 Q1286L Het
Tmem132d G A 5: 127,783,916 T1047I probably damaging Het
Togaram2 G A 17: 71,700,940 R420H probably damaging Het
Uimc1 G A 13: 55,093,267 R3* probably null Het
Vmn2r7 C T 3: 64,691,526 V537I probably benign Het
Wwp1 T A 4: 19,635,328 K584N probably damaging Het
Zc3h12d A T 10: 7,839,959 Q42L possibly damaging Het
Zfp729a A T 13: 67,621,450 V220E probably benign Het
Other mutations in Zfp91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02240:Zfp91 APN 19 12776406 splice site probably benign
R0139:Zfp91 UTSW 19 12770470 missense probably damaging 1.00
R0369:Zfp91 UTSW 19 12770074 missense possibly damaging 0.95
R0485:Zfp91 UTSW 19 12775989 splice site probably benign
R0559:Zfp91 UTSW 19 12770055 missense probably damaging 1.00
R0597:Zfp91 UTSW 19 12770095 missense possibly damaging 0.53
R1565:Zfp91 UTSW 19 12779075 missense probably benign 0.02
R3422:Zfp91 UTSW 19 12770292 missense probably benign 0.24
R4438:Zfp91 UTSW 19 12778021 nonsense probably null
R4898:Zfp91 UTSW 19 12770060 missense probably damaging 1.00
R4927:Zfp91 UTSW 19 12776410 critical splice donor site probably null
R5509:Zfp91 UTSW 19 12779087 missense probably damaging 0.99
R5878:Zfp91 UTSW 19 12770320 missense possibly damaging 0.80
R5978:Zfp91 UTSW 19 12770151 missense probably benign 0.43
R7703:Zfp91 UTSW 19 12776877 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AAGGCAGCAAGTAATTCCCC -3'
(R):5'- TCAACCTGCCTAATGTTTGGTG -3'

Sequencing Primer
(F):5'- GTGAAATAAATGCACTTCTACC -3'
(R):5'- ACTTTCTCACTGTAAAGAGTGTGTTG -3'
Posted On2019-12-20