Incidental Mutation 'R7866:Spc25'
ID 607758
Institutional Source Beutler Lab
Gene Symbol Spc25
Ensembl Gene ENSMUSG00000005233
Gene Name SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms 2600017H08Rik, 2610205L13Rik, Spbc25
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 69024239-69036538 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 69036406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000149045] [ENSMUST00000149643] [ENSMUST00000167875]
AlphaFold Q3UA16
Predicted Effect probably null
Transcript: ENSMUST00000005365
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112320
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127243
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149045
SMART Domains Protein: ENSMUSP00000120999
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 133 3.7e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149643
SMART Domains Protein: ENSMUSP00000117415
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
PDB:3IZ0|E 99 167 3e-22 PDB
Predicted Effect probably null
Transcript: ENSMUST00000167875
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the kinetochore-associated NDC80 protein complex, which is required for the mitotic spindle checkpoint and for microtubule-kinetochore attachment. During meiosis in mouse, the protein localizes to the germinal vesicle and then is associated with the chromosomes following germinal vesicle breakdown. Knockdown of this gene in oocytes results in precocious polar body extrusion, chromosome misalignment and aberrant spindle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Spc25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Spc25 APN 2 69,032,952 (GRCm39) nonsense probably null
IGL02273:Spc25 APN 2 69,035,273 (GRCm39) splice site probably benign
IGL03163:Spc25 APN 2 69,027,548 (GRCm39) missense probably damaging 1.00
R1519:Spc25 UTSW 2 69,030,431 (GRCm39) missense probably damaging 1.00
R1604:Spc25 UTSW 2 69,035,498 (GRCm39) missense probably damaging 0.99
R2913:Spc25 UTSW 2 69,030,331 (GRCm39) missense probably benign 0.42
R3973:Spc25 UTSW 2 69,032,945 (GRCm39) missense probably damaging 1.00
R4094:Spc25 UTSW 2 69,032,975 (GRCm39) missense probably damaging 1.00
R4444:Spc25 UTSW 2 69,035,220 (GRCm39) missense probably benign 0.06
R5293:Spc25 UTSW 2 69,032,996 (GRCm39) missense possibly damaging 0.92
R6242:Spc25 UTSW 2 69,027,555 (GRCm39) missense probably damaging 1.00
R6433:Spc25 UTSW 2 69,036,446 (GRCm39) utr 5 prime probably benign
R6721:Spc25 UTSW 2 69,027,517 (GRCm39) missense possibly damaging 0.96
R7712:Spc25 UTSW 2 69,036,481 (GRCm39) missense unknown
R8054:Spc25 UTSW 2 69,035,257 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGCATCAGACCCCTGG -3'
(R):5'- GTCAGCCAATCAGAAGACGG -3'

Sequencing Primer
(F):5'- ATCAGACCCCTGGCCGAC -3'
(R):5'- GAGTTGAAGGGCGGGTAAGC -3'
Posted On 2019-12-20