Incidental Mutation 'R7866:Actl6a'
ID 607762
Institutional Source Beutler Lab
Gene Symbol Actl6a
Ensembl Gene ENSMUSG00000027671
Gene Name actin-like 6A
Synonyms ARP4, Actl6, 2810432C06Rik, Baf53a
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 32762695-32781122 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32766262 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 39 (T39A)
Ref Sequence ENSEMBL: ENSMUSP00000029214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029214] [ENSMUST00000126144] [ENSMUST00000193615] [ENSMUST00000194781]
AlphaFold Q9Z2N8
Predicted Effect possibly damaging
Transcript: ENSMUST00000029214
AA Change: T39A

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029214
Gene: ENSMUSG00000027671
AA Change: T39A

DomainStartEndE-ValueType
ACTIN 11 429 1.37e-189 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126144
SMART Domains Protein: ENSMUSP00000114317
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
ACTIN 1 204 4.28e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193231
Predicted Effect probably benign
Transcript: ENSMUST00000193615
SMART Domains Protein: ENSMUSP00000141354
Gene: ENSMUSG00000027671

DomainStartEndE-ValueType
Pfam:Actin 8 60 1.5e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194781
AA Change: T43A

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141543
Gene: ENSMUSG00000027671
AA Change: T43A

DomainStartEndE-ValueType
ACTIN 15 245 1.5e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of actin-related proteins (ARPs), which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a 53 kDa subunit protein of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. Together with beta-actin, it is required for maximal ATPase activity of BRG1, and for the association of the BAF complex with chromatin/matrix. Three transcript variants that encode two different protein isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E6.5. Mice homozygous for a conditional allele activated in hematopoietic cells exhibit bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Actl6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Actl6a APN 3 32,766,313 (GRCm39) missense probably benign 0.01
IGL01691:Actl6a APN 3 32,774,349 (GRCm39) missense possibly damaging 0.94
IGL02902:Actl6a APN 3 32,776,791 (GRCm39) missense possibly damaging 0.93
R0194:Actl6a UTSW 3 32,779,469 (GRCm39) missense probably damaging 1.00
R1193:Actl6a UTSW 3 32,766,293 (GRCm39) missense probably benign 0.00
R1404:Actl6a UTSW 3 32,776,759 (GRCm39) unclassified probably benign
R1754:Actl6a UTSW 3 32,772,723 (GRCm39) missense probably damaging 1.00
R4289:Actl6a UTSW 3 32,766,263 (GRCm39) missense possibly damaging 0.87
R5020:Actl6a UTSW 3 32,774,656 (GRCm39) missense possibly damaging 0.79
R5165:Actl6a UTSW 3 32,774,357 (GRCm39) missense probably benign 0.01
R5272:Actl6a UTSW 3 32,772,759 (GRCm39) missense probably damaging 0.97
R5384:Actl6a UTSW 3 32,774,642 (GRCm39) missense probably damaging 1.00
R5640:Actl6a UTSW 3 32,772,199 (GRCm39) missense probably damaging 0.99
R5722:Actl6a UTSW 3 32,772,194 (GRCm39) missense probably damaging 0.97
R5865:Actl6a UTSW 3 32,766,277 (GRCm39) missense possibly damaging 0.80
R6208:Actl6a UTSW 3 32,766,043 (GRCm39) missense probably benign 0.05
R7094:Actl6a UTSW 3 32,760,487 (GRCm39) start gained probably benign
R7192:Actl6a UTSW 3 32,774,373 (GRCm39) missense probably damaging 1.00
R8734:Actl6a UTSW 3 32,774,104 (GRCm39) missense probably benign 0.06
R9022:Actl6a UTSW 3 32,769,649 (GRCm39) missense probably benign 0.03
R9075:Actl6a UTSW 3 32,769,641 (GRCm39) missense possibly damaging 0.94
R9209:Actl6a UTSW 3 32,779,469 (GRCm39) missense probably damaging 1.00
Z1176:Actl6a UTSW 3 32,780,692 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGGATCGTACACAGTGAGGG -3'
(R):5'- GTTTACAGCTAATTCATACCCATGC -3'

Sequencing Primer
(F):5'- TACACAGTGAGGGCTGGCTATG -3'
(R):5'- ATACCCATGCCATTCTTGAGTGG -3'
Posted On 2019-12-20