Incidental Mutation 'R7866:Atp6v0b'
ID 607765
Institutional Source Beutler Lab
Gene Symbol Atp6v0b
Ensembl Gene ENSMUSG00000033379
Gene Name ATPase, H+ transporting, lysosomal V0 subunit B
Synonyms VMA16, 2310024H13Rik, Atp6f
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 117741523-117744530 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117742350 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 181 (I181N)
Ref Sequence ENSEMBL: ENSMUSP00000047682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030265] [ENSMUST00000030266] [ENSMUST00000036380] [ENSMUST00000084325] [ENSMUST00000106421] [ENSMUST00000132073] [ENSMUST00000136596] [ENSMUST00000147845] [ENSMUST00000149868] [ENSMUST00000150204] [ENSMUST00000153358] [ENSMUST00000167443] [ENSMUST00000171548] [ENSMUST00000183773]
AlphaFold Q91V37
Predicted Effect probably benign
Transcript: ENSMUST00000030265
SMART Domains Protein: ENSMUSP00000030265
Gene: ENSMUSG00000028540

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 54 375 2.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030266
SMART Domains Protein: ENSMUSP00000030266
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 228 4.2e-59 PFAM
Pfam:Glyco_transf_7C 232 310 2.1e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036380
AA Change: I181N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047682
Gene: ENSMUSG00000033379
AA Change: I181N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:ATP-synt_C 50 112 1.2e-15 PFAM
Pfam:ATP-synt_C 136 198 1.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084325
SMART Domains Protein: ENSMUSP00000081352
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106421
SMART Domains Protein: ENSMUSP00000102029
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 230 1.9e-47 PFAM
Pfam:Glyco_transf_7C 232 310 2.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132073
SMART Domains Protein: ENSMUSP00000137654
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 1.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136596
Predicted Effect probably benign
Transcript: ENSMUST00000147845
Predicted Effect probably benign
Transcript: ENSMUST00000149868
SMART Domains Protein: ENSMUSP00000137788
Gene: ENSMUSG00000033379

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 3.1e-19 PFAM
transmembrane domain 84 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150204
AA Change: I134N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119988
Gene: ENSMUSG00000033379
AA Change: I134N

DomainStartEndE-ValueType
Pfam:ATP-synt_C 2 67 8.2e-19 PFAM
Pfam:ATP-synt_C 88 152 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153358
SMART Domains Protein: ENSMUSP00000120571
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 197 9.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167443
SMART Domains Protein: ENSMUSP00000128771
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_transf_7N 94 188 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171548
SMART Domains Protein: ENSMUSP00000126539
Gene: ENSMUSG00000028541

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183773
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Atp6v0b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Atp6v0b APN 4 117,742,303 (GRCm39) nonsense probably null
IGL01556:Atp6v0b APN 4 117,743,062 (GRCm39) missense probably damaging 1.00
IGL01998:Atp6v0b APN 4 117,743,263 (GRCm39) critical splice donor site probably null
IGL02369:Atp6v0b APN 4 117,742,850 (GRCm39) missense possibly damaging 0.95
IGL02953:Atp6v0b APN 4 117,742,419 (GRCm39) missense probably damaging 1.00
PIT4362001:Atp6v0b UTSW 4 117,742,453 (GRCm39) missense possibly damaging 0.88
R0244:Atp6v0b UTSW 4 117,741,819 (GRCm39) missense probably damaging 1.00
R5636:Atp6v0b UTSW 4 117,743,582 (GRCm39) unclassified probably benign
R6974:Atp6v0b UTSW 4 117,742,864 (GRCm39) missense probably benign 0.19
R7581:Atp6v0b UTSW 4 117,742,483 (GRCm39) missense probably benign 0.00
R7851:Atp6v0b UTSW 4 117,743,062 (GRCm39) missense probably damaging 1.00
X0057:Atp6v0b UTSW 4 117,743,820 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATTTTCAGAGGCAGCCGAGG -3'
(R):5'- TAGCCCACACTGGACCATTC -3'

Sequencing Primer
(F):5'- CAGCCGAGGAAAGAGATGCTAATG -3'
(R):5'- ACACTGGACCATTCCTCTCCTG -3'
Posted On 2019-12-20