Incidental Mutation 'R7866:Uba6'
ID 607766
Institutional Source Beutler Lab
Gene Symbol Uba6
Ensembl Gene ENSMUSG00000035898
Gene Name ubiquitin-like modifier activating enzyme 6
Synonyms Ube1l2, 5730469D23Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 86258579-86320602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86320560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 13 (E13G)
Ref Sequence ENSEMBL: ENSMUSP00000035328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039373] [ENSMUST00000113373]
AlphaFold Q8C7R4
Predicted Effect probably damaging
Transcript: ENSMUST00000039373
AA Change: E13G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035328
Gene: ENSMUSG00000035898
AA Change: E13G

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Pfam:ThiF 44 431 8.9e-29 PFAM
Pfam:E1_FCCH 224 293 1.7e-28 PFAM
Pfam:E1_4HB 294 362 9.8e-21 PFAM
internal_repeat_1 443 588 1.25e-6 PROSPERO
Pfam:UBA_e1_thiolCys 631 884 3.7e-80 PFAM
UBA_e1_C 921 1043 1.04e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113373
SMART Domains Protein: ENSMUSP00000109000
Gene: ENSMUSG00000035898

DomainStartEndE-ValueType
Pfam:ThiF 29 167 1.8e-16 PFAM
Pfam:ThiF 428 573 8.5e-34 PFAM
Pfam:UBA_e1_thiolCys 575 619 2.3e-22 PFAM
Pfam:UBACT 817 885 2.9e-28 PFAM
UBA_e1_C 890 1012 1.04e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of proteins with ubiquitin (UBB; MIM 191339) or ubiquitin-like proteins controls many signaling networks and requires a ubiquitin-activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin protein ligase (E3). UBE1L2 is an E1 enzyme that initiates the activation and conjugation of ubiquitin-like proteins (Jin et al., 2007 [PubMed 17597759]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. Mice homozygous for a conditional allele activated in neurons exhibit decreased weight, postnatal and premature lethality and altered social behavior and neuronal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Uba6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Uba6 APN 5 86,267,266 (GRCm39) missense possibly damaging 0.51
IGL01294:Uba6 APN 5 86,297,907 (GRCm39) missense possibly damaging 0.67
IGL01625:Uba6 APN 5 86,268,388 (GRCm39) nonsense probably null
IGL01807:Uba6 APN 5 86,270,270 (GRCm39) missense probably damaging 1.00
IGL01919:Uba6 APN 5 86,267,245 (GRCm39) missense probably benign 0.01
IGL02131:Uba6 APN 5 86,297,936 (GRCm39) missense probably benign 0.18
IGL03107:Uba6 APN 5 86,275,633 (GRCm39) splice site probably benign
R0314:Uba6 UTSW 5 86,265,946 (GRCm39) missense probably damaging 0.99
R0350:Uba6 UTSW 5 86,292,237 (GRCm39) missense possibly damaging 0.48
R0511:Uba6 UTSW 5 86,260,609 (GRCm39) missense probably damaging 1.00
R0964:Uba6 UTSW 5 86,267,260 (GRCm39) missense possibly damaging 0.47
R1086:Uba6 UTSW 5 86,275,578 (GRCm39) missense probably benign 0.00
R1440:Uba6 UTSW 5 86,288,282 (GRCm39) missense probably damaging 1.00
R1564:Uba6 UTSW 5 86,302,266 (GRCm39) missense probably benign
R2377:Uba6 UTSW 5 86,272,229 (GRCm39) missense possibly damaging 0.90
R2420:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2421:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2422:Uba6 UTSW 5 86,280,475 (GRCm39) critical splice donor site probably null
R2924:Uba6 UTSW 5 86,307,130 (GRCm39) missense probably damaging 1.00
R3723:Uba6 UTSW 5 86,282,906 (GRCm39) missense probably damaging 1.00
R3724:Uba6 UTSW 5 86,282,906 (GRCm39) missense probably damaging 1.00
R4429:Uba6 UTSW 5 86,268,406 (GRCm39) missense probably damaging 0.99
R4590:Uba6 UTSW 5 86,260,603 (GRCm39) missense probably damaging 1.00
R4831:Uba6 UTSW 5 86,279,197 (GRCm39) missense probably benign
R4908:Uba6 UTSW 5 86,288,293 (GRCm39) splice site silent
R5193:Uba6 UTSW 5 86,272,281 (GRCm39) missense probably benign 0.12
R5505:Uba6 UTSW 5 86,268,405 (GRCm39) missense probably benign 0.09
R5560:Uba6 UTSW 5 86,279,119 (GRCm39) missense probably damaging 1.00
R5586:Uba6 UTSW 5 86,282,906 (GRCm39) missense probably damaging 1.00
R5589:Uba6 UTSW 5 86,270,288 (GRCm39) missense probably damaging 0.99
R5787:Uba6 UTSW 5 86,260,511 (GRCm39) makesense probably null
R6255:Uba6 UTSW 5 86,312,624 (GRCm39) missense probably benign 0.25
R6512:Uba6 UTSW 5 86,272,262 (GRCm39) missense probably benign
R6772:Uba6 UTSW 5 86,294,932 (GRCm39) critical splice donor site probably benign
R7536:Uba6 UTSW 5 86,272,191 (GRCm39) missense probably benign 0.05
R7571:Uba6 UTSW 5 86,294,970 (GRCm39) missense probably benign 0.02
R7609:Uba6 UTSW 5 86,294,934 (GRCm39) missense probably benign 0.17
R7768:Uba6 UTSW 5 86,300,779 (GRCm39) missense probably benign 0.01
R7839:Uba6 UTSW 5 86,270,271 (GRCm39) splice site probably null
R7894:Uba6 UTSW 5 86,265,924 (GRCm39) nonsense probably null
R8063:Uba6 UTSW 5 86,300,544 (GRCm39) missense probably benign 0.29
R8276:Uba6 UTSW 5 86,290,509 (GRCm39) intron probably benign
R8382:Uba6 UTSW 5 86,279,196 (GRCm39) missense probably benign 0.01
R8516:Uba6 UTSW 5 86,275,607 (GRCm39) missense possibly damaging 0.78
R8673:Uba6 UTSW 5 86,284,178 (GRCm39) missense probably damaging 1.00
R8778:Uba6 UTSW 5 86,260,556 (GRCm39) missense possibly damaging 0.54
R8817:Uba6 UTSW 5 86,296,772 (GRCm39) missense probably null 0.10
R8822:Uba6 UTSW 5 86,294,932 (GRCm39) critical splice donor site probably benign
R8852:Uba6 UTSW 5 86,289,454 (GRCm39) missense possibly damaging 0.47
R8887:Uba6 UTSW 5 86,307,061 (GRCm39) critical splice donor site probably null
R9108:Uba6 UTSW 5 86,282,934 (GRCm39) missense possibly damaging 0.69
R9245:Uba6 UTSW 5 86,318,418 (GRCm39) missense probably damaging 1.00
R9511:Uba6 UTSW 5 86,288,219 (GRCm39) missense probably damaging 1.00
R9669:Uba6 UTSW 5 86,268,499 (GRCm39) missense probably benign 0.05
R9677:Uba6 UTSW 5 86,265,910 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCCTCTCCTGAATGACTGG -3'
(R):5'- TGACTGGAAACCCTGTCCTG -3'

Sequencing Primer
(F):5'- CGCTCAGAAGTAGTGACCTG -3'
(R):5'- GGGCGTACTTTTCCCCAG -3'
Posted On 2019-12-20