Incidental Mutation 'R7866:Pxn'
ID 607768
Institutional Source Beutler Lab
Gene Symbol Pxn
Ensembl Gene ENSMUSG00000029528
Gene Name paxillin
Synonyms Pax
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 115644735-115694046 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115686665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 386 (S386P)
Ref Sequence ENSEMBL: ENSMUSP00000148843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067268] [ENSMUST00000086523] [ENSMUST00000137716] [ENSMUST00000157050] [ENSMUST00000202564] [ENSMUST00000212819]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067268
SMART Domains Protein: ENSMUSP00000069624
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 1.6e-98 PFAM
low complexity region 281 300 N/A INTRINSIC
LIM 323 374 3.99e-23 SMART
LIM 382 433 2.36e-16 SMART
LIM 441 492 8.16e-20 SMART
LIM 500 551 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086523
SMART Domains Protein: ENSMUSP00000083709
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:Paxillin 44 253 4.8e-97 PFAM
low complexity region 315 334 N/A INTRINSIC
LIM 357 408 3.99e-23 SMART
LIM 416 467 2.36e-16 SMART
LIM 475 526 8.16e-20 SMART
LIM 534 585 8.62e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137716
SMART Domains Protein: ENSMUSP00000144513
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 1.9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000157050
SMART Domains Protein: ENSMUSP00000143926
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 106 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202564
SMART Domains Protein: ENSMUSP00000144459
Gene: ENSMUSG00000029528

DomainStartEndE-ValueType
Pfam:Paxillin 1 120 5.8e-59 PFAM
low complexity region 148 167 N/A INTRINSIC
LIM 190 241 1.9e-25 SMART
LIM 249 300 1.1e-18 SMART
LIM 308 359 4e-22 SMART
LIM 367 418 4.4e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212819
AA Change: S386P

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutant mice die at E9.5 with defects in the amnion, allantois, and headfold structures, as well as impaired growth, and abnormal heart and somite development; mutant fibroblasts show aberrant fibronectin-regulated focal adhesion dynamics, and disorganized membrane cytoskeletal structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Pxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Pxn APN 5 115,682,985 (GRCm39) missense probably benign 0.00
IGL02432:Pxn APN 5 115,683,805 (GRCm39) missense probably damaging 1.00
IGL02454:Pxn APN 5 115,690,325 (GRCm39) missense probably damaging 1.00
R0316:Pxn UTSW 5 115,692,027 (GRCm39) missense probably damaging 1.00
R0778:Pxn UTSW 5 115,690,236 (GRCm39) missense probably damaging 1.00
R1680:Pxn UTSW 5 115,690,206 (GRCm39) missense probably damaging 1.00
R1874:Pxn UTSW 5 115,683,049 (GRCm39) missense probably damaging 1.00
R2069:Pxn UTSW 5 115,683,726 (GRCm39) missense probably benign 0.26
R2145:Pxn UTSW 5 115,690,815 (GRCm39) unclassified probably benign
R4124:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4126:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4127:Pxn UTSW 5 115,684,966 (GRCm39) missense probably damaging 1.00
R4551:Pxn UTSW 5 115,690,779 (GRCm39) unclassified probably benign
R4717:Pxn UTSW 5 115,690,001 (GRCm39) missense probably damaging 0.99
R5217:Pxn UTSW 5 115,682,974 (GRCm39) missense probably benign 0.13
R5332:Pxn UTSW 5 115,682,428 (GRCm39) missense probably damaging 1.00
R5635:Pxn UTSW 5 115,689,551 (GRCm39) missense probably benign
R5681:Pxn UTSW 5 115,682,593 (GRCm39) missense possibly damaging 0.94
R6629:Pxn UTSW 5 115,692,121 (GRCm39) missense probably damaging 1.00
R6702:Pxn UTSW 5 115,689,955 (GRCm39) missense probably benign 0.11
R7516:Pxn UTSW 5 115,644,922 (GRCm39) missense unknown
R7671:Pxn UTSW 5 115,686,606 (GRCm39) missense not run
R7749:Pxn UTSW 5 115,686,575 (GRCm39) missense probably benign 0.00
R8196:Pxn UTSW 5 115,683,768 (GRCm39) missense probably damaging 0.99
R8244:Pxn UTSW 5 115,690,302 (GRCm39) missense probably damaging 1.00
R9096:Pxn UTSW 5 115,686,680 (GRCm39) missense probably benign 0.23
X0018:Pxn UTSW 5 115,683,791 (GRCm39) missense probably damaging 1.00
X0025:Pxn UTSW 5 115,684,954 (GRCm39) missense probably damaging 0.97
X0065:Pxn UTSW 5 115,689,546 (GRCm39) critical splice acceptor site probably null
Z1177:Pxn UTSW 5 115,691,952 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACACAGAAGGAAGTAGTCAGGTC -3'
(R):5'- CTTGCCGATCTAATGCCACG -3'

Sequencing Primer
(F):5'- GAAGGAAGTAGTCAGGTCCTTTTACC -3'
(R):5'- TCAAGCCCTTCCTGAAAGCTG -3'
Posted On 2019-12-20