Incidental Mutation 'R7866:Vps29'
ID 607769
Institutional Source Beutler Lab
Gene Symbol Vps29
Ensembl Gene ENSMUSG00000029462
Gene Name VPS29 retromer complex component
Synonyms PEP11, 2010015D08Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 122492432-122503047 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122500180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 97 (W97R)
Ref Sequence ENSEMBL: ENSMUSP00000113525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031419] [ENSMUST00000111729] [ENSMUST00000117868] [ENSMUST00000118765] [ENSMUST00000118830] [ENSMUST00000145821] [ENSMUST00000154686] [ENSMUST00000155671]
AlphaFold Q9QZ88
PDB Structure Crystal structure of mouse Vps29 complexed with Mn2+ [X-RAY DIFFRACTION]
Crystal structure of mouse Vps29 [X-RAY DIFFRACTION]
Crystal structure of mouse VPS29 complexed with Mn2+ [X-RAY DIFFRACTION]
Crystal structure of mouse VPS29 complexed with Zn2+ [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031419
SMART Domains Protein: ENSMUSP00000031419
Gene: ENSMUSG00000029463

DomainStartEndE-ValueType
Pfam:FAM216B 50 160 6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111729
SMART Domains Protein: ENSMUSP00000107358
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117868
AA Change: W93R

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113345
Gene: ENSMUSG00000029462
AA Change: W93R

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 143 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118765
SMART Domains Protein: ENSMUSP00000112579
Gene: ENSMUSG00000029462

DomainStartEndE-ValueType
PDB:1W24|A 1 65 7e-42 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000118830
AA Change: W97R

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113525
Gene: ENSMUSG00000029462
AA Change: W97R

DomainStartEndE-ValueType
Pfam:Metallophos_2 6 162 1.6e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145821
AA Change: W102R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123593
Gene: ENSMUSG00000029462
AA Change: W102R

DomainStartEndE-ValueType
Pfam:Metallophos_2 11 124 1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154686
Predicted Effect possibly damaging
Transcript: ENSMUST00000155671
AA Change: W93R

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121020
Gene: ENSMUSG00000029462
AA Change: W93R

DomainStartEndE-ValueType
Pfam:Metallophos_2 1 158 3.4e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a group of vacuolar protein sorting (VPS) genes that, when functionally impaired, disrupt the efficient delivery of vacuolar hydrolases. The protein encoded by this gene is a component of a large multimeric complex, termed the retromer complex, which is involved in retrograde transport of proteins from endosomes to the trans-Golgi network. This VPS protein may be involved in the formation of the inner shell of the retromer coat for retrograde vesicles leaving the prevacuolar compartment. Alternative splice variants encoding different isoforms and representing non-protein coding transcripts have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Vps29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01700:Vps29 APN 5 122,500,930 (GRCm39) missense probably damaging 1.00
IGL02627:Vps29 APN 5 122,500,908 (GRCm39) missense probably benign 0.00
IGL02716:Vps29 APN 5 122,500,129 (GRCm39) missense probably benign 0.20
R4807:Vps29 UTSW 5 122,500,951 (GRCm39) missense probably damaging 1.00
R5619:Vps29 UTSW 5 122,492,511 (GRCm39) utr 5 prime probably benign
R7431:Vps29 UTSW 5 122,492,541 (GRCm39) missense probably benign
R8167:Vps29 UTSW 5 122,500,877 (GRCm39) missense possibly damaging 0.95
R8971:Vps29 UTSW 5 122,498,212 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GTGTCACAGGTTGATGAGAAACTTC -3'
(R):5'- CCTACGCTGTGGTACTTACG -3'

Sequencing Primer
(F):5'- GTGCTGCCTGAAGATACCTATGAG -3'
(R):5'- CGTTTCCAAGGCATTATAGGC -3'
Posted On 2019-12-20