Incidental Mutation 'R7866:Snd1'
ID 607771
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Name staphylococcal nuclease and tudor domain containing 1
Synonyms Tudor-SN, p100 co-activator
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 28480332-28935161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28527724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 277 (I277N)
Ref Sequence ENSEMBL: ENSMUSP00000001460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000168362]
AlphaFold Q78PY7
Predicted Effect probably damaging
Transcript: ENSMUST00000001460
AA Change: I277N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: I277N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000164915
AA Change: S251T
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424
AA Change: S251T

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167201
AA Change: I277N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424
AA Change: I277N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28,512,985 (GRCm39) critical splice donor site probably null
IGL00940:Snd1 APN 6 28,745,174 (GRCm39) intron probably benign
IGL01340:Snd1 APN 6 28,883,368 (GRCm39) missense probably benign
IGL01892:Snd1 APN 6 28,888,123 (GRCm39) critical splice donor site probably null
IGL02063:Snd1 APN 6 28,526,220 (GRCm39) unclassified probably benign
IGL02134:Snd1 APN 6 28,880,278 (GRCm39) missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28,707,149 (GRCm39) intron probably benign
PIT4677001:Snd1 UTSW 6 28,880,295 (GRCm39) missense probably benign 0.01
R0039:Snd1 UTSW 6 28,745,209 (GRCm39) missense probably damaging 1.00
R0053:Snd1 UTSW 6 28,745,334 (GRCm39) intron probably benign
R0053:Snd1 UTSW 6 28,745,334 (GRCm39) intron probably benign
R0463:Snd1 UTSW 6 28,724,955 (GRCm39) missense probably benign 0.00
R0576:Snd1 UTSW 6 28,886,576 (GRCm39) missense probably benign 0.31
R0709:Snd1 UTSW 6 28,545,469 (GRCm39) splice site probably benign
R0959:Snd1 UTSW 6 28,884,970 (GRCm39) missense probably benign 0.01
R1698:Snd1 UTSW 6 28,888,252 (GRCm39) nonsense probably null
R1853:Snd1 UTSW 6 28,545,563 (GRCm39) missense probably damaging 1.00
R2059:Snd1 UTSW 6 28,745,206 (GRCm39) missense probably damaging 1.00
R2497:Snd1 UTSW 6 28,888,078 (GRCm39) missense probably benign
R3832:Snd1 UTSW 6 28,531,403 (GRCm39) splice site probably benign
R3833:Snd1 UTSW 6 28,531,403 (GRCm39) splice site probably benign
R4643:Snd1 UTSW 6 28,880,248 (GRCm39) missense probably benign 0.00
R4665:Snd1 UTSW 6 28,707,053 (GRCm39) missense probably damaging 1.00
R4843:Snd1 UTSW 6 28,668,642 (GRCm39) missense probably damaging 1.00
R4884:Snd1 UTSW 6 28,526,911 (GRCm39) missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28,884,250 (GRCm39) nonsense probably null
R4973:Snd1 UTSW 6 28,884,250 (GRCm39) nonsense probably null
R5065:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5066:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5067:Snd1 UTSW 6 28,888,239 (GRCm39) missense probably damaging 1.00
R5131:Snd1 UTSW 6 28,885,049 (GRCm39) missense probably damaging 0.99
R5172:Snd1 UTSW 6 28,886,615 (GRCm39) missense possibly damaging 0.91
R5239:Snd1 UTSW 6 28,545,524 (GRCm39) missense probably damaging 1.00
R5313:Snd1 UTSW 6 28,668,600 (GRCm39) missense probably benign 0.15
R5395:Snd1 UTSW 6 28,526,183 (GRCm39) missense probably damaging 0.99
R5938:Snd1 UTSW 6 28,874,858 (GRCm39) critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28,880,233 (GRCm39) missense probably benign 0.00
R6248:Snd1 UTSW 6 28,520,234 (GRCm39) nonsense probably null
R6337:Snd1 UTSW 6 28,888,288 (GRCm39) missense probably damaging 1.00
R6810:Snd1 UTSW 6 28,668,609 (GRCm39) missense probably benign 0.23
R6932:Snd1 UTSW 6 28,626,100 (GRCm39) missense probably benign 0.42
R7469:Snd1 UTSW 6 28,626,126 (GRCm39) missense probably damaging 1.00
R7485:Snd1 UTSW 6 28,531,449 (GRCm39) missense probably benign 0.14
R7571:Snd1 UTSW 6 28,526,202 (GRCm39) missense possibly damaging 0.81
R8178:Snd1 UTSW 6 28,874,975 (GRCm39) missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28,526,054 (GRCm39) missense possibly damaging 0.86
R8526:Snd1 UTSW 6 28,745,253 (GRCm39) missense probably benign 0.00
R8848:Snd1 UTSW 6 28,874,962 (GRCm39) missense possibly damaging 0.72
R8854:Snd1 UTSW 6 28,526,968 (GRCm39) missense probably benign 0.02
R9310:Snd1 UTSW 6 28,795,936 (GRCm39) missense probably null 1.00
R9326:Snd1 UTSW 6 28,795,842 (GRCm39) nonsense probably null
R9348:Snd1 UTSW 6 28,745,206 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGAGTTCAGGCTGTGG -3'
(R):5'- AGCCTGGAACACTTGAGATG -3'

Sequencing Primer
(F):5'- ATGCCCCTTGGAAGCCTGATG -3'
(R):5'- GCCTGGAACACTTGAGATGAACTTAC -3'
Posted On 2019-12-20