Incidental Mutation 'R7866:Klk1b22'
ID 607775
Institutional Source Beutler Lab
Gene Symbol Klk1b22
Ensembl Gene ENSMUSG00000060177
Gene Name kallikrein 1-related peptidase b22
Synonyms Klk22, Egfbp1, Egfbp-1, mGk-22
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43762097-43766346 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43762168 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 15 (I15F)
Ref Sequence ENSEMBL: ENSMUSP00000076733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077528]
AlphaFold P15948
Predicted Effect possibly damaging
Transcript: ENSMUST00000077528
AA Change: I15F

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076733
Gene: ENSMUSG00000060177
AA Change: I15F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 251 2.91e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the 7S nerve growth factor (NGF) complex that is essential for the differentiation and survival of distinct populations of neurons in both the central and the peripheral nervous systems. The encoded preproprotein undergoes proteolytic processing to generate a functional, mature peptide. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Klk1b22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Klk1b22 APN 7 43,765,732 (GRCm39) missense probably damaging 1.00
IGL02189:Klk1b22 APN 7 43,765,630 (GRCm39) splice site probably null
R1117:Klk1b22 UTSW 7 43,766,283 (GRCm39) missense probably benign 0.00
R1480:Klk1b22 UTSW 7 43,766,278 (GRCm39) missense possibly damaging 0.51
R1581:Klk1b22 UTSW 7 43,765,399 (GRCm39) missense possibly damaging 0.72
R1793:Klk1b22 UTSW 7 43,765,775 (GRCm39) splice site probably benign
R2935:Klk1b22 UTSW 7 43,764,146 (GRCm39) missense probably benign 0.22
R5806:Klk1b22 UTSW 7 43,765,301 (GRCm39) missense possibly damaging 0.90
R7278:Klk1b22 UTSW 7 43,764,173 (GRCm39) missense probably benign 0.01
R7443:Klk1b22 UTSW 7 43,765,534 (GRCm39) missense probably benign
R7646:Klk1b22 UTSW 7 43,765,542 (GRCm39) splice site probably null
R8499:Klk1b22 UTSW 7 43,762,144 (GRCm39) missense probably benign 0.42
R8829:Klk1b22 UTSW 7 43,764,277 (GRCm39) missense probably benign
R8832:Klk1b22 UTSW 7 43,764,277 (GRCm39) missense probably benign
R9113:Klk1b22 UTSW 7 43,765,692 (GRCm39) missense possibly damaging 0.81
R9756:Klk1b22 UTSW 7 43,765,254 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACATCAGGTGCAACAGGACC -3'
(R):5'- TCTTTCCTGGGAGCAAGGAC -3'

Sequencing Primer
(F):5'- TAAGTGCAGGGAATCCACCTCTG -3'
(R):5'- ACTGTGAAGGTCCGATCACTG -3'
Posted On 2019-12-20