Incidental Mutation 'R7866:Ap3m2'
ID 607779
Institutional Source Beutler Lab
Gene Symbol Ap3m2
Ensembl Gene ENSMUSG00000031539
Gene Name adaptor-related protein complex 3, mu 2 subunit
Synonyms 5830445E16Rik, AP-3B
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 23277370-23295638 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23289674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 143 (V143A)
Ref Sequence ENSEMBL: ENSMUSP00000128446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163739] [ENSMUST00000210656]
AlphaFold Q8R2R9
Predicted Effect probably benign
Transcript: ENSMUST00000163739
AA Change: V143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000128446
Gene: ENSMUSG00000031539
AA Change: V143A

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 2.7e-8 PFAM
Pfam:Adap_comp_sub 165 418 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210656
AA Change: V143A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice suffer from spontaneous recurrent epileptic seizures, are more susceptible to drug-induced seizures and show impaired GABA release, fewer synaptic vesicles, enhanced long-term potentiation, and abnormal propagation of neuronal excitability via the temporoammonic pathway. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Ap3m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Ap3m2 APN 8 23,287,243 (GRCm39) splice site probably null
IGL01288:Ap3m2 APN 8 23,293,931 (GRCm39) missense probably benign
IGL01391:Ap3m2 APN 8 23,289,663 (GRCm39) missense probably benign 0.00
R0599:Ap3m2 UTSW 8 23,283,128 (GRCm39) missense possibly damaging 0.88
R1566:Ap3m2 UTSW 8 23,293,967 (GRCm39) missense probably damaging 1.00
R1576:Ap3m2 UTSW 8 23,298,483 (GRCm39) unclassified probably benign
R2917:Ap3m2 UTSW 8 23,289,815 (GRCm39) missense probably benign 0.00
R4884:Ap3m2 UTSW 8 23,293,997 (GRCm39) missense probably damaging 1.00
R4995:Ap3m2 UTSW 8 23,293,792 (GRCm39) missense probably benign 0.19
R5100:Ap3m2 UTSW 8 23,279,404 (GRCm39) missense probably benign
R5738:Ap3m2 UTSW 8 23,293,877 (GRCm39) missense possibly damaging 0.52
R7030:Ap3m2 UTSW 8 23,289,807 (GRCm39) missense probably damaging 0.99
R7378:Ap3m2 UTSW 8 23,294,026 (GRCm39) missense probably benign 0.31
R7602:Ap3m2 UTSW 8 23,282,770 (GRCm39) missense probably benign 0.00
R7732:Ap3m2 UTSW 8 23,287,105 (GRCm39) missense probably benign 0.00
R8288:Ap3m2 UTSW 8 23,283,153 (GRCm39) missense probably benign 0.03
R9181:Ap3m2 UTSW 8 23,289,774 (GRCm39) missense probably damaging 1.00
R9358:Ap3m2 UTSW 8 23,280,959 (GRCm39) missense possibly damaging 0.53
Z1177:Ap3m2 UTSW 8 23,281,337 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTACAACAGGTGCCATGC -3'
(R):5'- ACAATTCTTATGTCTTCATCAGGAC -3'

Sequencing Primer
(F):5'- TGCCACCAGGTGCTACATAAAATTG -3'
(R):5'- CTTCATCAGGACTATTTTGGGGTC -3'
Posted On 2019-12-20