Incidental Mutation 'R7866:Adgrl1'
ID 607780
Institutional Source Beutler Lab
Gene Symbol Adgrl1
Ensembl Gene ENSMUSG00000013033
Gene Name adhesion G protein-coupled receptor L1
Synonyms Lec2, 2900070I05Rik, lectomedin-2, Lphn1
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 84626734-84668583 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 84664564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]
AlphaFold Q80TR1
Predicted Effect probably null
Transcript: ENSMUST00000045393
SMART Domains Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 6.6e-23 PFAM
OLF 142 398 8.5e-138 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 1.4e-23 SMART
low complexity region 579 591 N/A INTRINSIC
low complexity region 747 758 N/A INTRINSIC
GPS 797 849 3.5e-27 SMART
Pfam:7tm_2 856 1092 5.3e-66 PFAM
Pfam:Latrophilin 1112 1470 1.7e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098595
SMART Domains Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124355
SMART Domains Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131018
SMART Domains Protein: ENSMUSP00000117720
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
Pfam:Latrophilin 1 213 9.2e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131717
SMART Domains Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
OLF 1 222 4.51e-103 SMART
low complexity region 229 265 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
HormR 300 365 2.26e-21 SMART
low complexity region 403 415 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
GPS 621 673 5.64e-25 SMART
Pfam:7tm_2 680 916 7.9e-68 PFAM
Pfam:Latrophilin 936 1295 2.7e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132500
SMART Domains Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 1.6e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 3.4e-68 PFAM
Pfam:Latrophilin 1146 1511 6.4e-193 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000141158
SMART Domains Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 3.4e-25 PFAM
OLF 137 393 1.39e-135 SMART
low complexity region 400 436 N/A INTRINSIC
low complexity region 450 465 N/A INTRINSIC
HormR 471 536 2.26e-21 SMART
low complexity region 574 586 N/A INTRINSIC
low complexity region 742 753 N/A INTRINSIC
GPS 792 844 5.64e-25 SMART
Pfam:7tm_2 851 1087 4.5e-68 PFAM
Pfam:Latrophilin 1107 1466 1.1e-180 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000152978
SMART Domains Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Gal_Lectin 48 128 2.1e-25 PFAM
OLF 142 398 1.39e-135 SMART
low complexity region 405 441 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
HormR 476 541 2.26e-21 SMART
Pfam:GAIN 544 773 4.1e-59 PFAM
GPS 797 849 5.64e-25 SMART
Pfam:7tm_2 856 1092 2.3e-69 PFAM
Pfam:Latrophilin 1112 1516 7.3e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Adgrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adgrl1 APN 8 84,664,332 (GRCm39) missense probably damaging 0.98
IGL01413:Adgrl1 APN 8 84,656,486 (GRCm39) missense probably damaging 1.00
IGL02020:Adgrl1 APN 8 84,659,577 (GRCm39) missense probably benign 0.09
IGL02422:Adgrl1 APN 8 84,664,115 (GRCm39) missense probably damaging 1.00
IGL03065:Adgrl1 APN 8 84,665,143 (GRCm39) missense possibly damaging 0.95
IGL03169:Adgrl1 APN 8 84,658,624 (GRCm39) missense probably damaging 0.97
IGL03237:Adgrl1 APN 8 84,656,312 (GRCm39) splice site probably null
Swiss_rolls UTSW 8 84,645,551 (GRCm39) missense probably damaging 0.99
R0375:Adgrl1 UTSW 8 84,661,530 (GRCm39) missense probably damaging 0.99
R0505:Adgrl1 UTSW 8 84,661,279 (GRCm39) splice site probably benign
R0681:Adgrl1 UTSW 8 84,661,279 (GRCm39) splice site probably benign
R0964:Adgrl1 UTSW 8 84,661,041 (GRCm39) splice site probably benign
R1182:Adgrl1 UTSW 8 84,656,451 (GRCm39) missense probably damaging 1.00
R1373:Adgrl1 UTSW 8 84,664,392 (GRCm39) missense probably benign 0.23
R1475:Adgrl1 UTSW 8 84,664,979 (GRCm39) missense possibly damaging 0.60
R1610:Adgrl1 UTSW 8 84,659,002 (GRCm39) missense probably benign 0.16
R1778:Adgrl1 UTSW 8 84,656,666 (GRCm39) missense probably damaging 1.00
R2089:Adgrl1 UTSW 8 84,661,093 (GRCm39) missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 84,661,093 (GRCm39) missense probably damaging 1.00
R2091:Adgrl1 UTSW 8 84,661,093 (GRCm39) missense probably damaging 1.00
R2300:Adgrl1 UTSW 8 84,656,746 (GRCm39) nonsense probably null
R2403:Adgrl1 UTSW 8 84,657,870 (GRCm39) missense probably benign 0.01
R2935:Adgrl1 UTSW 8 84,661,189 (GRCm39) missense probably damaging 1.00
R3772:Adgrl1 UTSW 8 84,649,633 (GRCm39) missense possibly damaging 0.59
R4191:Adgrl1 UTSW 8 84,665,569 (GRCm39) missense probably benign 0.29
R4393:Adgrl1 UTSW 8 84,665,222 (GRCm39) missense probably benign 0.01
R4406:Adgrl1 UTSW 8 84,656,671 (GRCm39) missense probably damaging 1.00
R4445:Adgrl1 UTSW 8 84,661,489 (GRCm39) missense probably damaging 1.00
R4782:Adgrl1 UTSW 8 84,662,202 (GRCm39) missense probably benign 0.08
R4799:Adgrl1 UTSW 8 84,662,202 (GRCm39) missense probably benign 0.08
R5214:Adgrl1 UTSW 8 84,642,202 (GRCm39) splice site probably null
R5242:Adgrl1 UTSW 8 84,657,711 (GRCm39) missense possibly damaging 0.47
R5409:Adgrl1 UTSW 8 84,656,371 (GRCm39) missense probably damaging 1.00
R5522:Adgrl1 UTSW 8 84,649,704 (GRCm39) missense possibly damaging 0.93
R5607:Adgrl1 UTSW 8 84,663,886 (GRCm39) missense probably damaging 1.00
R5608:Adgrl1 UTSW 8 84,663,886 (GRCm39) missense probably damaging 1.00
R5652:Adgrl1 UTSW 8 84,656,444 (GRCm39) missense probably damaging 1.00
R5655:Adgrl1 UTSW 8 84,665,230 (GRCm39) missense possibly damaging 0.89
R5919:Adgrl1 UTSW 8 84,659,239 (GRCm39) missense probably damaging 1.00
R6033:Adgrl1 UTSW 8 84,645,551 (GRCm39) missense probably damaging 0.99
R6033:Adgrl1 UTSW 8 84,645,551 (GRCm39) missense probably damaging 0.99
R6129:Adgrl1 UTSW 8 84,645,616 (GRCm39) missense probably damaging 1.00
R6221:Adgrl1 UTSW 8 84,664,316 (GRCm39) nonsense probably null
R7142:Adgrl1 UTSW 8 84,663,829 (GRCm39) missense probably benign 0.38
R7181:Adgrl1 UTSW 8 84,652,878 (GRCm39) splice site probably null
R7238:Adgrl1 UTSW 8 84,665,693 (GRCm39) missense probably damaging 0.99
R7547:Adgrl1 UTSW 8 84,665,513 (GRCm39) missense probably benign 0.00
R7709:Adgrl1 UTSW 8 84,665,617 (GRCm39) missense probably benign 0.03
R7741:Adgrl1 UTSW 8 84,656,343 (GRCm39) missense probably damaging 1.00
R7852:Adgrl1 UTSW 8 84,662,187 (GRCm39) missense probably damaging 1.00
R8146:Adgrl1 UTSW 8 84,657,618 (GRCm39) missense possibly damaging 0.64
R8314:Adgrl1 UTSW 8 84,665,018 (GRCm39) missense probably damaging 1.00
R8829:Adgrl1 UTSW 8 84,665,458 (GRCm39) missense
R8857:Adgrl1 UTSW 8 84,657,657 (GRCm39) missense probably benign 0.24
R8979:Adgrl1 UTSW 8 84,665,015 (GRCm39) missense probably benign 0.12
R9204:Adgrl1 UTSW 8 84,660,519 (GRCm39) missense probably benign 0.03
R9226:Adgrl1 UTSW 8 84,656,426 (GRCm39) missense possibly damaging 0.91
R9302:Adgrl1 UTSW 8 84,656,426 (GRCm39) missense possibly damaging 0.91
R9695:Adgrl1 UTSW 8 84,665,060 (GRCm39) missense probably damaging 0.99
R9785:Adgrl1 UTSW 8 84,665,168 (GRCm39) missense probably damaging 1.00
RF007:Adgrl1 UTSW 8 84,661,401 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CAATACACTCATTGCAGAGTCC -3'
(R):5'- ACACTCCCTAGGCTTGAACTC -3'

Sequencing Primer
(F):5'- AGAGTCCGTGGGCTTCAATC -3'
(R):5'- CCTAGGCTTGAACTCCCCAG -3'
Posted On 2019-12-20