Incidental Mutation 'R7866:Dpep2'
ID 607781
Institutional Source Beutler Lab
Gene Symbol Dpep2
Ensembl Gene ENSMUSG00000115067
Gene Name dipeptidase 2
Synonyms F630103D06Rik, MBD-2
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.144) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 106711577-106732658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106716113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 267 (T267A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034373] [ENSMUST00000117555] [ENSMUST00000142898] [ENSMUST00000227363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034373
AA Change: T172A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034373
Gene: ENSMUSG00000053687
AA Change: T172A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Peptidase_M19 80 401 3.4e-112 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000080659
Gene: ENSMUSG00000115067
AA Change: T267A

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
Pfam:Peptidase_M19 166 501 1.2e-104 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117555
AA Change: T79A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113877
Gene: ENSMUSG00000053687
AA Change: T79A

DomainStartEndE-ValueType
Pfam:Peptidase_M19 1 308 5.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Predicted Effect possibly damaging
Transcript: ENSMUST00000227363
AA Change: T258A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DPEP2 belongs to the membrane-bound dipeptidase (EC 3.4.13.19) family. These enzymes hydrolyze a variety of dipeptides, including leukotriene D4, the beta-lactam ring of some antibiotics, and cystinyl-bis-glycine (cys-bis-gly) formed during glutathione degradation (Habib et al., 2003 [PubMed 12738806]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Dpep2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Dpep2 APN 8 106,715,453 (GRCm39) missense probably damaging 1.00
IGL01160:Dpep2 APN 8 106,713,076 (GRCm39) missense possibly damaging 0.95
IGL02071:Dpep2 APN 8 106,711,776 (GRCm39) missense probably benign 0.01
IGL02441:Dpep2 APN 8 106,711,723 (GRCm39) missense probably benign 0.00
IGL02517:Dpep2 APN 8 106,715,388 (GRCm39) missense probably damaging 1.00
IGL02836:Dpep2 APN 8 106,717,227 (GRCm39) critical splice donor site probably null
G1citation:Dpep2 UTSW 8 106,711,873 (GRCm39) missense probably benign 0.01
R0504:Dpep2 UTSW 8 106,716,620 (GRCm39) missense probably benign 0.29
R1866:Dpep2 UTSW 8 106,716,080 (GRCm39) critical splice donor site probably null
R1982:Dpep2 UTSW 8 106,716,087 (GRCm39) nonsense probably null
R2172:Dpep2 UTSW 8 106,715,630 (GRCm39) missense possibly damaging 0.88
R2399:Dpep2 UTSW 8 106,716,224 (GRCm39) missense probably damaging 1.00
R4369:Dpep2 UTSW 8 106,711,707 (GRCm39) missense probably benign 0.00
R4499:Dpep2 UTSW 8 106,712,114 (GRCm39) missense probably benign 0.32
R4500:Dpep2 UTSW 8 106,712,114 (GRCm39) missense probably benign 0.32
R4774:Dpep2 UTSW 8 106,717,388 (GRCm39) missense possibly damaging 0.48
R5114:Dpep2 UTSW 8 106,712,825 (GRCm39) missense probably damaging 1.00
R5727:Dpep2 UTSW 8 106,713,075 (GRCm39) missense probably benign 0.00
R6052:Dpep2 UTSW 8 106,717,270 (GRCm39) missense possibly damaging 0.91
R6177:Dpep2 UTSW 8 106,712,831 (GRCm39) missense probably damaging 1.00
R6658:Dpep2 UTSW 8 106,716,542 (GRCm39) missense probably benign 0.01
R6822:Dpep2 UTSW 8 106,711,873 (GRCm39) missense probably benign 0.01
R7854:Dpep2 UTSW 8 106,716,160 (GRCm39) missense
R8169:Dpep2 UTSW 8 106,722,849 (GRCm39) missense
R9047:Dpep2 UTSW 8 106,715,944 (GRCm39) missense
R9203:Dpep2 UTSW 8 106,712,885 (GRCm39) missense probably damaging 1.00
R9222:Dpep2 UTSW 8 106,723,016 (GRCm39) missense
V7732:Dpep2 UTSW 8 106,715,892 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCGAAGCACAGCGAGG -3'
(R):5'- GTCAGATTCATTACATGTGGCC -3'

Sequencing Primer
(F):5'- GCTGTTGTCTAGTGAATGGCCAC -3'
(R):5'- CAAGTCTGTCCATTGTAAGGCCAAG -3'
Posted On 2019-12-20