Incidental Mutation 'R7866:Col6a6'
ID 607786
Institutional Source Beutler Lab
Gene Symbol Col6a6
Ensembl Gene ENSMUSG00000043719
Gene Name collagen, type VI, alpha 6
Synonyms E330026B02Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 105566616-105705413 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105566760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 2245 (Y2245C)
Ref Sequence ENSEMBL: ENSMUSP00000096040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065778] [ENSMUST00000098441] [ENSMUST00000166431] [ENSMUST00000191268]
AlphaFold Q8C6K9
Predicted Effect probably benign
Transcript: ENSMUST00000065778
SMART Domains Protein: ENSMUSP00000067400
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 1.7e-5 PFAM
Pfam:Pkinase 26 312 1.2e-18 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098441
AA Change: Y2245C

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096040
Gene: ENSMUSG00000043719
AA Change: Y2245C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 3.3e-9 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166431
AA Change: Y2245C

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125765
Gene: ENSMUSG00000043719
AA Change: Y2245C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
VWA 24 197 4.26e-26 SMART
VWA 226 407 1.06e-30 SMART
VWA 433 610 5.19e-39 SMART
VWA 619 795 3.58e-42 SMART
VWA 806 982 6.64e-37 SMART
VWA 997 1175 2.7e-37 SMART
VWA 1184 1370 3.45e-1 SMART
Pfam:Collagen 1389 1450 9.3e-10 PFAM
low complexity region 1451 1475 N/A INTRINSIC
low complexity region 1490 1508 N/A INTRINSIC
low complexity region 1602 1623 N/A INTRINSIC
low complexity region 1698 1724 N/A INTRINSIC
VWA 1754 1937 1.73e-17 SMART
VWA 1962 2145 4.4e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191268
SMART Domains Protein: ENSMUSP00000139427
Gene: ENSMUSG00000032571

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 310 8.9e-7 PFAM
Pfam:Pkinase 26 312 3.7e-23 PFAM
coiled coil region 941 963 N/A INTRINSIC
WD40 982 1021 3.99e-8 SMART
WD40 1031 1070 6.16e0 SMART
WD40 1132 1169 4.58e1 SMART
WD40 1171 1214 1.64e2 SMART
WD40 1228 1269 2.76e-2 SMART
WD40 1317 1358 2.96e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Col6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Col6a6 APN 9 105,635,390 (GRCm39) critical splice acceptor site probably null
IGL00768:Col6a6 APN 9 105,659,611 (GRCm39) missense probably benign 0.04
IGL00917:Col6a6 APN 9 105,661,453 (GRCm39) splice site probably benign
IGL01385:Col6a6 APN 9 105,660,865 (GRCm39) missense probably damaging 1.00
IGL01411:Col6a6 APN 9 105,663,157 (GRCm39) nonsense probably null
IGL01508:Col6a6 APN 9 105,604,365 (GRCm39) splice site probably benign
IGL01668:Col6a6 APN 9 105,586,470 (GRCm39) missense probably damaging 1.00
IGL01733:Col6a6 APN 9 105,586,454 (GRCm39) missense possibly damaging 0.92
IGL01932:Col6a6 APN 9 105,566,825 (GRCm39) missense probably benign 0.02
IGL01934:Col6a6 APN 9 105,575,858 (GRCm39) critical splice donor site probably null
IGL01944:Col6a6 APN 9 105,661,108 (GRCm39) missense probably damaging 1.00
IGL01980:Col6a6 APN 9 105,658,184 (GRCm39) missense probably damaging 0.96
IGL02114:Col6a6 APN 9 105,644,398 (GRCm39) critical splice donor site probably null
IGL02129:Col6a6 APN 9 105,613,539 (GRCm39) splice site probably benign
IGL02201:Col6a6 APN 9 105,658,194 (GRCm39) missense probably damaging 1.00
IGL02335:Col6a6 APN 9 105,661,300 (GRCm39) missense probably damaging 1.00
IGL02541:Col6a6 APN 9 105,609,415 (GRCm39) missense probably benign 0.05
IGL02574:Col6a6 APN 9 105,659,390 (GRCm39) missense probably damaging 1.00
IGL02649:Col6a6 APN 9 105,604,369 (GRCm39) critical splice donor site probably null
IGL02852:Col6a6 APN 9 105,661,272 (GRCm39) missense probably damaging 0.99
IGL03278:Col6a6 APN 9 105,586,651 (GRCm39) missense probably benign 0.01
IGL03327:Col6a6 APN 9 105,644,433 (GRCm39) missense possibly damaging 0.90
PIT4519001:Col6a6 UTSW 9 105,609,462 (GRCm39) missense probably benign 0.23
R0042:Col6a6 UTSW 9 105,657,896 (GRCm39) missense possibly damaging 0.89
R0046:Col6a6 UTSW 9 105,626,047 (GRCm39) splice site probably benign
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0066:Col6a6 UTSW 9 105,579,412 (GRCm39) missense probably damaging 0.99
R0140:Col6a6 UTSW 9 105,579,474 (GRCm39) missense probably damaging 1.00
R0278:Col6a6 UTSW 9 105,644,487 (GRCm39) missense possibly damaging 0.87
R0281:Col6a6 UTSW 9 105,661,315 (GRCm39) missense probably benign 0.13
R0382:Col6a6 UTSW 9 105,632,754 (GRCm39) missense probably damaging 0.98
R0389:Col6a6 UTSW 9 105,661,403 (GRCm39) missense probably benign 0.02
R0421:Col6a6 UTSW 9 105,661,405 (GRCm39) missense probably benign 0.02
R0502:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0503:Col6a6 UTSW 9 105,644,550 (GRCm39) missense probably benign 0.04
R0600:Col6a6 UTSW 9 105,638,639 (GRCm39) missense probably damaging 1.00
R0626:Col6a6 UTSW 9 105,654,943 (GRCm39) missense probably benign 0.45
R0629:Col6a6 UTSW 9 105,604,364 (GRCm39) splice site probably benign
R0690:Col6a6 UTSW 9 105,586,685 (GRCm39) missense probably benign 0.01
R1155:Col6a6 UTSW 9 105,659,289 (GRCm39) missense possibly damaging 0.64
R1245:Col6a6 UTSW 9 105,626,109 (GRCm39) missense possibly damaging 0.62
R1253:Col6a6 UTSW 9 105,651,502 (GRCm39) missense probably null 0.98
R1263:Col6a6 UTSW 9 105,586,688 (GRCm39) missense probably benign 0.01
R1296:Col6a6 UTSW 9 105,658,290 (GRCm39) missense probably damaging 1.00
R1556:Col6a6 UTSW 9 105,586,672 (GRCm39) missense possibly damaging 0.82
R1600:Col6a6 UTSW 9 105,655,274 (GRCm39) missense probably damaging 1.00
R1612:Col6a6 UTSW 9 105,654,748 (GRCm39) missense probably damaging 1.00
R1613:Col6a6 UTSW 9 105,609,410 (GRCm39) critical splice donor site probably null
R1830:Col6a6 UTSW 9 105,579,469 (GRCm39) missense probably damaging 0.99
R1858:Col6a6 UTSW 9 105,658,301 (GRCm39) missense probably damaging 1.00
R1897:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R1944:Col6a6 UTSW 9 105,586,583 (GRCm39) missense probably damaging 1.00
R2366:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R2484:Col6a6 UTSW 9 105,658,003 (GRCm39) missense probably damaging 0.98
R3079:Col6a6 UTSW 9 105,631,422 (GRCm39) missense probably benign 0.01
R3176:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3276:Col6a6 UTSW 9 105,663,429 (GRCm39) missense probably benign 0.01
R3429:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R3716:Col6a6 UTSW 9 105,659,373 (GRCm39) missense probably damaging 0.98
R3809:Col6a6 UTSW 9 105,657,891 (GRCm39) missense probably damaging 1.00
R3978:Col6a6 UTSW 9 105,576,078 (GRCm39) missense probably damaging 0.98
R4087:Col6a6 UTSW 9 105,661,155 (GRCm39) missense possibly damaging 0.68
R4382:Col6a6 UTSW 9 105,660,889 (GRCm39) missense probably damaging 1.00
R4516:Col6a6 UTSW 9 105,576,148 (GRCm39) missense possibly damaging 0.64
R4666:Col6a6 UTSW 9 105,644,541 (GRCm39) missense possibly damaging 0.93
R4905:Col6a6 UTSW 9 105,644,623 (GRCm39) missense probably damaging 1.00
R4923:Col6a6 UTSW 9 105,666,147 (GRCm39) missense probably damaging 1.00
R4951:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R5002:Col6a6 UTSW 9 105,663,292 (GRCm39) missense probably benign 0.00
R5111:Col6a6 UTSW 9 105,586,673 (GRCm39) missense possibly damaging 0.70
R5205:Col6a6 UTSW 9 105,659,232 (GRCm39) missense probably damaging 0.99
R5399:Col6a6 UTSW 9 105,586,306 (GRCm39) missense possibly damaging 0.50
R5475:Col6a6 UTSW 9 105,651,537 (GRCm39) missense probably null 0.79
R5491:Col6a6 UTSW 9 105,615,435 (GRCm39) missense probably damaging 0.98
R5758:Col6a6 UTSW 9 105,638,717 (GRCm39) critical splice acceptor site probably null
R5934:Col6a6 UTSW 9 105,644,274 (GRCm39) missense probably damaging 1.00
R6059:Col6a6 UTSW 9 105,661,116 (GRCm39) missense probably damaging 1.00
R6284:Col6a6 UTSW 9 105,604,426 (GRCm39) splice site probably null
R6425:Col6a6 UTSW 9 105,576,064 (GRCm39) missense probably benign 0.21
R6464:Col6a6 UTSW 9 105,666,152 (GRCm39) start codon destroyed probably null 0.60
R6469:Col6a6 UTSW 9 105,575,890 (GRCm39) missense probably damaging 0.97
R6520:Col6a6 UTSW 9 105,663,024 (GRCm39) missense possibly damaging 0.89
R6552:Col6a6 UTSW 9 105,576,112 (GRCm39) missense probably damaging 1.00
R6750:Col6a6 UTSW 9 105,660,879 (GRCm39) missense probably damaging 1.00
R6813:Col6a6 UTSW 9 105,661,140 (GRCm39) missense probably benign 0.32
R7032:Col6a6 UTSW 9 105,644,707 (GRCm39) missense probably damaging 0.96
R7260:Col6a6 UTSW 9 105,661,168 (GRCm39) missense probably benign 0.00
R7472:Col6a6 UTSW 9 105,659,622 (GRCm39) missense probably damaging 1.00
R7541:Col6a6 UTSW 9 105,644,523 (GRCm39) missense probably damaging 1.00
R7640:Col6a6 UTSW 9 105,662,943 (GRCm39) missense possibly damaging 0.74
R7645:Col6a6 UTSW 9 105,644,397 (GRCm39) critical splice donor site probably null
R7716:Col6a6 UTSW 9 105,661,102 (GRCm39) missense possibly damaging 0.84
R7938:Col6a6 UTSW 9 105,657,883 (GRCm39) nonsense probably null
R8016:Col6a6 UTSW 9 105,644,727 (GRCm39) missense possibly damaging 0.73
R8043:Col6a6 UTSW 9 105,576,219 (GRCm39) missense probably damaging 0.98
R8073:Col6a6 UTSW 9 105,659,146 (GRCm39) missense probably benign 0.01
R8082:Col6a6 UTSW 9 105,661,129 (GRCm39) nonsense probably null
R8243:Col6a6 UTSW 9 105,576,468 (GRCm39) missense probably damaging 1.00
R8306:Col6a6 UTSW 9 105,661,272 (GRCm39) missense probably damaging 0.96
R8324:Col6a6 UTSW 9 105,632,853 (GRCm39) missense probably benign 0.25
R8384:Col6a6 UTSW 9 105,632,893 (GRCm39) missense probably damaging 1.00
R8400:Col6a6 UTSW 9 105,651,995 (GRCm39) missense probably damaging 1.00
R8523:Col6a6 UTSW 9 105,651,987 (GRCm39) missense possibly damaging 0.71
R8842:Col6a6 UTSW 9 105,655,166 (GRCm39) missense probably damaging 1.00
R8862:Col6a6 UTSW 9 105,663,348 (GRCm39) missense probably damaging 1.00
R8907:Col6a6 UTSW 9 105,644,528 (GRCm39) missense probably damaging 0.99
R9021:Col6a6 UTSW 9 105,586,745 (GRCm39) missense possibly damaging 0.85
R9088:Col6a6 UTSW 9 105,661,276 (GRCm39) missense probably damaging 0.99
R9178:Col6a6 UTSW 9 105,659,169 (GRCm39) missense probably benign 0.30
R9225:Col6a6 UTSW 9 105,659,437 (GRCm39) missense possibly damaging 0.75
R9340:Col6a6 UTSW 9 105,651,757 (GRCm39) missense probably damaging 1.00
R9342:Col6a6 UTSW 9 105,663,172 (GRCm39) missense probably benign 0.00
R9360:Col6a6 UTSW 9 105,644,686 (GRCm39) missense probably benign 0.00
R9368:Col6a6 UTSW 9 105,663,300 (GRCm39) missense possibly damaging 0.48
R9398:Col6a6 UTSW 9 105,651,825 (GRCm39) missense probably benign 0.40
R9450:Col6a6 UTSW 9 105,661,373 (GRCm39) missense probably benign
R9454:Col6a6 UTSW 9 105,661,059 (GRCm39) missense probably damaging 0.99
R9458:Col6a6 UTSW 9 105,586,361 (GRCm39) missense probably benign 0.01
R9563:Col6a6 UTSW 9 105,572,952 (GRCm39) missense probably benign 0.02
R9568:Col6a6 UTSW 9 105,657,926 (GRCm39) missense possibly damaging 0.58
R9613:Col6a6 UTSW 9 105,616,401 (GRCm39) missense probably benign 0.07
R9664:Col6a6 UTSW 9 105,658,254 (GRCm39) missense probably benign 0.11
R9747:Col6a6 UTSW 9 105,661,239 (GRCm39) missense probably benign 0.29
R9760:Col6a6 UTSW 9 105,659,253 (GRCm39) missense probably damaging 0.99
X0022:Col6a6 UTSW 9 105,576,531 (GRCm39) missense probably damaging 1.00
Z1176:Col6a6 UTSW 9 105,658,151 (GRCm39) missense probably damaging 1.00
Z1177:Col6a6 UTSW 9 105,666,094 (GRCm39) missense probably null 0.24
Z1177:Col6a6 UTSW 9 105,605,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAATCCCATGAGTGTAGGGG -3'
(R):5'- AAAGGTTGCCATGGAGCCAG -3'

Sequencing Primer
(F):5'- GTCAAGGCACCTGACTGC -3'
(R):5'- TGCCATGGAGCCAGTTGGG -3'
Posted On 2019-12-20