Incidental Mutation 'R7866:Ppfia2'
ID 607790
Institutional Source Beutler Lab
Gene Symbol Ppfia2
Ensembl Gene ENSMUSG00000053825
Gene Name protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms Liprin-alpha2, E130120L08Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 106305129-106769329 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106655390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 319 (N319I)
Ref Sequence ENSEMBL: ENSMUSP00000151545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029404] [ENSMUST00000217854]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029404
AA Change: N319I

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029404
Gene: ENSMUSG00000053825
AA Change: N319I

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
coiled coil region 32 80 N/A INTRINSIC
coiled coil region 102 150 N/A INTRINSIC
coiled coil region 189 234 N/A INTRINSIC
coiled coil region 267 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
coiled coil region 643 691 N/A INTRINSIC
low complexity region 702 725 N/A INTRINSIC
SAM 895 964 6.27e-10 SMART
low complexity region 965 977 N/A INTRINSIC
SAM 1017 1084 1.69e-6 SMART
SAM 1105 1177 6.62e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217854
AA Change: N319I

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein has been shown to bind the calcium/calmodulin-dependent serine protein kinase (MAGUK family) protein (also known as CASK) and proposed to regulate higher-order brain functions in mammals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Ppfia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Ppfia2 APN 10 106,655,353 (GRCm39) missense probably benign 0.25
IGL01296:Ppfia2 APN 10 106,694,068 (GRCm39) missense probably damaging 0.98
IGL01385:Ppfia2 APN 10 106,749,560 (GRCm39) missense probably damaging 1.00
IGL01592:Ppfia2 APN 10 106,671,909 (GRCm39) splice site probably benign
IGL01899:Ppfia2 APN 10 106,751,612 (GRCm39) critical splice donor site probably null
IGL02063:Ppfia2 APN 10 106,740,706 (GRCm39) missense probably null 0.83
IGL02143:Ppfia2 APN 10 106,693,360 (GRCm39) missense probably damaging 1.00
IGL02170:Ppfia2 APN 10 106,636,646 (GRCm39) missense probably benign
IGL02565:Ppfia2 APN 10 106,699,247 (GRCm39) critical splice donor site probably null
IGL02573:Ppfia2 APN 10 106,664,789 (GRCm39) missense probably damaging 1.00
IGL02819:Ppfia2 APN 10 106,742,255 (GRCm39) missense probably damaging 1.00
IGL02974:Ppfia2 APN 10 106,636,637 (GRCm39) missense probably benign 0.08
IGL03165:Ppfia2 APN 10 106,603,348 (GRCm39) missense probably damaging 1.00
IGL03255:Ppfia2 APN 10 106,732,368 (GRCm39) missense possibly damaging 0.76
Colorless UTSW 10 106,749,455 (GRCm39) missense probably damaging 1.00
PIT4458001:Ppfia2 UTSW 10 106,763,708 (GRCm39) missense probably benign 0.24
R0018:Ppfia2 UTSW 10 106,678,647 (GRCm39) splice site probably benign
R0018:Ppfia2 UTSW 10 106,678,647 (GRCm39) splice site probably benign
R0323:Ppfia2 UTSW 10 106,732,281 (GRCm39) missense possibly damaging 0.84
R0391:Ppfia2 UTSW 10 106,666,575 (GRCm39) splice site probably benign
R0667:Ppfia2 UTSW 10 106,749,555 (GRCm39) missense probably damaging 0.97
R0782:Ppfia2 UTSW 10 106,763,592 (GRCm39) missense probably benign 0.32
R0905:Ppfia2 UTSW 10 106,655,372 (GRCm39) missense probably benign 0.43
R1401:Ppfia2 UTSW 10 106,666,518 (GRCm39) missense possibly damaging 0.94
R1672:Ppfia2 UTSW 10 106,666,429 (GRCm39) missense possibly damaging 0.53
R1723:Ppfia2 UTSW 10 106,751,533 (GRCm39) splice site probably null
R1780:Ppfia2 UTSW 10 106,732,368 (GRCm39) missense possibly damaging 0.76
R1847:Ppfia2 UTSW 10 106,763,571 (GRCm39) missense probably benign 0.16
R2015:Ppfia2 UTSW 10 106,310,538 (GRCm39) missense probably benign 0.01
R2051:Ppfia2 UTSW 10 106,673,160 (GRCm39) missense probably damaging 0.98
R2061:Ppfia2 UTSW 10 106,673,190 (GRCm39) missense possibly damaging 0.94
R2115:Ppfia2 UTSW 10 106,597,972 (GRCm39) missense probably damaging 1.00
R2310:Ppfia2 UTSW 10 106,690,841 (GRCm39) missense probably damaging 0.99
R2394:Ppfia2 UTSW 10 106,655,351 (GRCm39) missense probably damaging 0.99
R2656:Ppfia2 UTSW 10 106,701,268 (GRCm39) splice site probably null
R3113:Ppfia2 UTSW 10 106,742,256 (GRCm39) nonsense probably null
R3968:Ppfia2 UTSW 10 106,742,382 (GRCm39) missense probably damaging 0.99
R3977:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R3978:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R3979:Ppfia2 UTSW 10 106,666,490 (GRCm39) missense possibly damaging 0.69
R4567:Ppfia2 UTSW 10 106,701,267 (GRCm39) splice site probably null
R4632:Ppfia2 UTSW 10 106,671,905 (GRCm39) splice site probably null
R4718:Ppfia2 UTSW 10 106,694,146 (GRCm39) missense probably damaging 1.00
R4758:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4770:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4810:Ppfia2 UTSW 10 106,751,551 (GRCm39) missense probably benign 0.01
R4841:Ppfia2 UTSW 10 106,690,818 (GRCm39) missense probably benign 0.04
R4842:Ppfia2 UTSW 10 106,690,818 (GRCm39) missense probably benign 0.04
R4914:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4916:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R4917:Ppfia2 UTSW 10 106,597,978 (GRCm39) missense probably damaging 1.00
R5014:Ppfia2 UTSW 10 106,701,224 (GRCm39) nonsense probably null
R5029:Ppfia2 UTSW 10 106,693,304 (GRCm39) missense probably benign 0.04
R5127:Ppfia2 UTSW 10 106,671,621 (GRCm39) missense probably damaging 0.99
R5357:Ppfia2 UTSW 10 106,740,708 (GRCm39) critical splice donor site probably null
R5420:Ppfia2 UTSW 10 106,671,562 (GRCm39) missense possibly damaging 0.88
R6030:Ppfia2 UTSW 10 106,742,338 (GRCm39) missense probably damaging 1.00
R6030:Ppfia2 UTSW 10 106,742,338 (GRCm39) missense probably damaging 1.00
R6135:Ppfia2 UTSW 10 106,693,430 (GRCm39) missense probably damaging 1.00
R6237:Ppfia2 UTSW 10 106,749,455 (GRCm39) missense probably damaging 1.00
R6433:Ppfia2 UTSW 10 106,749,559 (GRCm39) missense possibly damaging 0.94
R6457:Ppfia2 UTSW 10 106,729,361 (GRCm39) missense probably damaging 1.00
R6542:Ppfia2 UTSW 10 106,671,586 (GRCm39) missense probably damaging 0.99
R6674:Ppfia2 UTSW 10 106,763,633 (GRCm39) missense probably benign 0.23
R6746:Ppfia2 UTSW 10 106,742,319 (GRCm39) nonsense probably null
R6992:Ppfia2 UTSW 10 106,310,715 (GRCm39) missense possibly damaging 0.88
R7060:Ppfia2 UTSW 10 106,597,970 (GRCm39) missense probably damaging 1.00
R7346:Ppfia2 UTSW 10 106,693,356 (GRCm39) missense possibly damaging 0.79
R7453:Ppfia2 UTSW 10 106,763,691 (GRCm39) missense possibly damaging 0.82
R7555:Ppfia2 UTSW 10 106,763,687 (GRCm39) missense probably benign 0.00
R7622:Ppfia2 UTSW 10 106,666,520 (GRCm39) missense possibly damaging 0.86
R7637:Ppfia2 UTSW 10 106,701,264 (GRCm39) critical splice donor site probably null
R7897:Ppfia2 UTSW 10 106,655,399 (GRCm39) missense probably damaging 0.99
R7937:Ppfia2 UTSW 10 106,699,233 (GRCm39) missense probably benign 0.30
R7938:Ppfia2 UTSW 10 106,310,648 (GRCm39) missense probably damaging 0.97
R8218:Ppfia2 UTSW 10 106,699,236 (GRCm39) missense probably benign 0.07
R8431:Ppfia2 UTSW 10 106,671,952 (GRCm39) nonsense probably null
R8806:Ppfia2 UTSW 10 106,694,114 (GRCm39) missense probably damaging 1.00
R8984:Ppfia2 UTSW 10 106,694,439 (GRCm39) intron probably benign
R9008:Ppfia2 UTSW 10 106,655,220 (GRCm39) missense probably benign 0.00
R9014:Ppfia2 UTSW 10 106,763,666 (GRCm39) missense probably benign 0.05
R9182:Ppfia2 UTSW 10 106,763,640 (GRCm39) missense probably benign 0.39
R9201:Ppfia2 UTSW 10 106,678,640 (GRCm39) critical splice donor site probably null
R9249:Ppfia2 UTSW 10 106,749,429 (GRCm39) missense probably damaging 1.00
R9620:Ppfia2 UTSW 10 106,749,519 (GRCm39) missense
R9710:Ppfia2 UTSW 10 106,664,885 (GRCm39) missense probably benign 0.00
X0021:Ppfia2 UTSW 10 106,310,538 (GRCm39) missense probably benign 0.06
X0022:Ppfia2 UTSW 10 106,729,295 (GRCm39) missense probably damaging 1.00
Z1176:Ppfia2 UTSW 10 106,310,506 (GRCm39) missense probably damaging 0.97
Z1177:Ppfia2 UTSW 10 106,742,416 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGCAGCGTCTATCCAATG -3'
(R):5'- GTAAACCATTTCTGTCTTCCTGAAC -3'

Sequencing Primer
(F):5'- TGGCTCCATAGATTCGACAGATGAC -3'
(R):5'- GAGCTTCTCAGAGCAACAT -3'
Posted On 2019-12-20