Incidental Mutation 'R7866:Gabrb2'
ID 607791
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Name gamma-aminobutyric acid type A receptor subunit beta 2
Synonyms C030021G16Rik, Gabrb-2, C030002O17Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.402) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 42310584-42519855 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 42378050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 89 (Q89*)
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
AlphaFold P63137
Predicted Effect probably null
Transcript: ENSMUST00000007797
AA Change: Q89*
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: Q89*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000192403
AA Change: Q89*
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: Q89*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42,482,721 (GRCm39) missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42,420,322 (GRCm39) critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42,312,227 (GRCm39) missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42,482,771 (GRCm39) missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42,312,258 (GRCm39) splice site probably benign
R0049:Gabrb2 UTSW 11 42,484,674 (GRCm39) missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42,484,674 (GRCm39) missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42,378,141 (GRCm39) missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42,420,298 (GRCm39) missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42,482,715 (GRCm39) missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42,517,540 (GRCm39) missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42,484,659 (GRCm39) missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42,312,255 (GRCm39) critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42,482,691 (GRCm39) missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42,482,734 (GRCm39) missense probably benign
R2993:Gabrb2 UTSW 11 42,488,476 (GRCm39) missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42,517,708 (GRCm39) missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42,312,155 (GRCm39) unclassified probably benign
R4168:Gabrb2 UTSW 11 42,312,155 (GRCm39) unclassified probably benign
R4497:Gabrb2 UTSW 11 42,488,521 (GRCm39) missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42,484,744 (GRCm39) missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42,488,469 (GRCm39) missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42,420,330 (GRCm39) splice site probably benign
R5345:Gabrb2 UTSW 11 42,517,636 (GRCm39) missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42,312,216 (GRCm39) missense probably benign
R5575:Gabrb2 UTSW 11 42,420,365 (GRCm39) intron probably benign
R5701:Gabrb2 UTSW 11 42,378,201 (GRCm39) missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42,312,216 (GRCm39) missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42,517,696 (GRCm39) missense probably damaging 1.00
R6738:Gabrb2 UTSW 11 42,484,758 (GRCm39) missense possibly damaging 0.95
R6930:Gabrb2 UTSW 11 42,488,440 (GRCm39) missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42,517,488 (GRCm39) missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42,484,758 (GRCm39) missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42,517,569 (GRCm39) missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42,378,039 (GRCm39) missense probably damaging 1.00
R8094:Gabrb2 UTSW 11 42,488,370 (GRCm39) missense probably damaging 0.98
R8402:Gabrb2 UTSW 11 42,378,131 (GRCm39) missense probably damaging 1.00
R8488:Gabrb2 UTSW 11 42,517,491 (GRCm39) missense possibly damaging 0.85
R8851:Gabrb2 UTSW 11 42,312,186 (GRCm39) missense probably benign
R9123:Gabrb2 UTSW 11 42,482,693 (GRCm39) missense probably damaging 0.97
R9125:Gabrb2 UTSW 11 42,482,693 (GRCm39) missense probably damaging 0.97
R9186:Gabrb2 UTSW 11 42,378,200 (GRCm39) missense possibly damaging 0.51
R9672:Gabrb2 UTSW 11 42,312,207 (GRCm39) missense probably benign 0.00
R9746:Gabrb2 UTSW 11 42,517,436 (GRCm39) missense probably benign 0.00
RF008:Gabrb2 UTSW 11 42,517,705 (GRCm39) missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42,313,473 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CTGAGAAAACCAAGTGCCTATC -3'
(R):5'- CGGGATGCAATCGAATCATACG -3'

Sequencing Primer
(F):5'- TGCATTCTTCTTTGTAAAACAACAG -3'
(R):5'- CGAATCATACGGTTTTTGACAGTCAC -3'
Posted On 2019-12-20