Incidental Mutation 'R7866:Fnip1'
ID 607792
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Name folliculin interacting protein 1
Synonyms A730024A03Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.790) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 54329025-54409061 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) T to G at 54356228 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
AlphaFold Q68FD7
Predicted Effect probably benign
Transcript: ENSMUST00000046835
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143650
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54,390,334 (GRCm39) missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54,384,126 (GRCm39) missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54,381,738 (GRCm39) missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54,378,589 (GRCm39) missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54,384,200 (GRCm39) missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54,390,393 (GRCm39) splice site probably benign
IGL02639:Fnip1 APN 11 54,366,466 (GRCm39) nonsense probably null
IGL02742:Fnip1 APN 11 54,384,177 (GRCm39) missense probably damaging 1.00
hamel UTSW 11 54,371,511 (GRCm39) critical splice donor site probably benign
hamel2 UTSW 11 54,393,097 (GRCm39) missense probably damaging 1.00
Normandy UTSW 11 54,384,007 (GRCm39) splice site probably benign
H8562:Fnip1 UTSW 11 54,371,123 (GRCm39) missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54,394,051 (GRCm39) missense probably benign 0.00
R0114:Fnip1 UTSW 11 54,378,627 (GRCm39) splice site probably benign
R0278:Fnip1 UTSW 11 54,380,169 (GRCm39) splice site probably null
R0409:Fnip1 UTSW 11 54,371,180 (GRCm39) splice site probably null
R0840:Fnip1 UTSW 11 54,384,007 (GRCm39) splice site probably benign
R1131:Fnip1 UTSW 11 54,384,129 (GRCm39) missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54,393,132 (GRCm39) missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54,394,123 (GRCm39) missense probably benign
R1817:Fnip1 UTSW 11 54,393,279 (GRCm39) missense probably benign 0.30
R1826:Fnip1 UTSW 11 54,356,990 (GRCm39) missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54,378,561 (GRCm39) missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54,406,373 (GRCm39) missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54,371,510 (GRCm39) missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54,373,329 (GRCm39) missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54,391,450 (GRCm39) missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54,356,933 (GRCm39) missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54,366,563 (GRCm39) missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54,393,503 (GRCm39) missense probably benign 0.32
R2863:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54,393,250 (GRCm39) missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54,371,065 (GRCm39) splice site probably null
R4017:Fnip1 UTSW 11 54,400,813 (GRCm39) missense probably benign 0.14
R4033:Fnip1 UTSW 11 54,393,297 (GRCm39) missense probably benign 0.02
R4668:Fnip1 UTSW 11 54,394,385 (GRCm39) missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54,390,245 (GRCm39) missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54,390,352 (GRCm39) missense probably benign 0.01
R4762:Fnip1 UTSW 11 54,356,997 (GRCm39) missense probably damaging 1.00
R4777:Fnip1 UTSW 11 54,391,382 (GRCm39) missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54,406,382 (GRCm39) missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54,393,415 (GRCm39) missense probably benign
R5481:Fnip1 UTSW 11 54,393,470 (GRCm39) missense probably benign 0.01
R5562:Fnip1 UTSW 11 54,380,168 (GRCm39) critical splice donor site probably null
R5563:Fnip1 UTSW 11 54,395,688 (GRCm39) missense probably benign 0.05
R5628:Fnip1 UTSW 11 54,394,459 (GRCm39) missense probably benign 0.08
R5689:Fnip1 UTSW 11 54,393,115 (GRCm39) missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54,393,097 (GRCm39) missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54,400,826 (GRCm39) missense probably benign 0.23
R6429:Fnip1 UTSW 11 54,406,393 (GRCm39) missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54,393,437 (GRCm39) missense probably benign 0.03
R6600:Fnip1 UTSW 11 54,393,925 (GRCm39) missense probably benign
R6882:Fnip1 UTSW 11 54,400,724 (GRCm39) missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54,373,385 (GRCm39) missense probably benign 0.00
R7009:Fnip1 UTSW 11 54,393,761 (GRCm39) missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54,356,951 (GRCm39) missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54,406,325 (GRCm39) missense probably benign 0.41
R7939:Fnip1 UTSW 11 54,393,093 (GRCm39) missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54,393,214 (GRCm39) missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54,366,522 (GRCm39) missense possibly damaging 0.94
R8546:Fnip1 UTSW 11 54,400,826 (GRCm39) missense probably benign 0.23
R8753:Fnip1 UTSW 11 54,400,867 (GRCm39) missense probably damaging 0.99
R8834:Fnip1 UTSW 11 54,395,581 (GRCm39) missense possibly damaging 0.83
R8875:Fnip1 UTSW 11 54,406,380 (GRCm39) missense probably damaging 1.00
R9605:Fnip1 UTSW 11 54,381,713 (GRCm39) missense probably benign 0.02
R9735:Fnip1 UTSW 11 54,394,273 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCTTGGTATGTAGGGTCACAC -3'
(R):5'- CAGGTTTGCAATAGGTCAAAACAG -3'

Sequencing Primer
(F):5'- GTATGTAGGGTCACACTTCTATCAG -3'
(R):5'- GGCACACAAAAAGCTACTGCATTTTC -3'
Posted On 2019-12-20