Incidental Mutation 'R7866:Zfp735'
ID 607794
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Name zinc finger protein 735
Synonyms 1700012C15Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 73579604-73604624 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73601629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 191 (D191A)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
AlphaFold B1ARH2
Predicted Effect probably benign
Transcript: ENSMUST00000080407
AA Change: D191A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: D191A

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73,602,192 (GRCm39) missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73,602,386 (GRCm39) missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73,601,305 (GRCm39) missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73,581,191 (GRCm39) missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73,602,254 (GRCm39) missense probably benign 0.01
IGL02238:Zfp735 APN 11 73,601,319 (GRCm39) missense probably benign 0.00
IGL02505:Zfp735 APN 11 73,580,626 (GRCm39) missense probably benign 0.03
IGL02740:Zfp735 APN 11 73,601,412 (GRCm39) missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73,601,755 (GRCm39) missense probably benign 0.00
bananaquit UTSW 11 73,601,412 (GRCm39) nonsense probably null
bescher UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
Galvanic UTSW 11 73,602,504 (GRCm39) nonsense probably null
grassquit UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R0114:Zfp735 UTSW 11 73,601,488 (GRCm39) missense probably benign 0.33
R0217:Zfp735 UTSW 11 73,602,112 (GRCm39) missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73,602,909 (GRCm39) missense probably benign 0.04
R1421:Zfp735 UTSW 11 73,601,523 (GRCm39) missense probably benign
R1460:Zfp735 UTSW 11 73,603,159 (GRCm39) missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73,601,305 (GRCm39) missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73,601,470 (GRCm39) missense probably benign
R1676:Zfp735 UTSW 11 73,602,301 (GRCm39) missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73,602,589 (GRCm39) missense probably benign 0.01
R1871:Zfp735 UTSW 11 73,601,412 (GRCm39) nonsense probably null
R1931:Zfp735 UTSW 11 73,602,677 (GRCm39) missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73,601,851 (GRCm39) missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73,602,223 (GRCm39) nonsense probably null
R2227:Zfp735 UTSW 11 73,602,222 (GRCm39) missense possibly damaging 0.53
R3552:Zfp735 UTSW 11 73,602,067 (GRCm39) nonsense probably null
R3856:Zfp735 UTSW 11 73,602,282 (GRCm39) missense probably benign 0.01
R3925:Zfp735 UTSW 11 73,601,950 (GRCm39) missense probably benign 0.33
R4572:Zfp735 UTSW 11 73,580,611 (GRCm39) missense probably benign 0.02
R4585:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73,602,031 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,682 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,681 (GRCm39) missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73,602,939 (GRCm39) missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73,601,419 (GRCm39) nonsense probably null
R5516:Zfp735 UTSW 11 73,601,640 (GRCm39) missense probably benign
R5654:Zfp735 UTSW 11 73,602,964 (GRCm39) missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73,581,174 (GRCm39) missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73,602,504 (GRCm39) nonsense probably null
R6427:Zfp735 UTSW 11 73,581,140 (GRCm39) missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73,602,478 (GRCm39) missense probably benign 0.33
R6820:Zfp735 UTSW 11 73,579,783 (GRCm39) start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73,601,880 (GRCm39) missense probably benign 0.08
R6941:Zfp735 UTSW 11 73,581,159 (GRCm39) missense probably benign 0.33
R7335:Zfp735 UTSW 11 73,602,379 (GRCm39) missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73,602,002 (GRCm39) missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73,581,154 (GRCm39) missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73,601,933 (GRCm39) missense possibly damaging 0.86
R8005:Zfp735 UTSW 11 73,603,140 (GRCm39) nonsense probably null
R8500:Zfp735 UTSW 11 73,601,811 (GRCm39) missense possibly damaging 0.53
R8551:Zfp735 UTSW 11 73,603,122 (GRCm39) missense probably benign 0.06
R8754:Zfp735 UTSW 11 73,603,000 (GRCm39) missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73,581,127 (GRCm39) missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73,601,692 (GRCm39) missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73,602,510 (GRCm39) missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73,602,699 (GRCm39) missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9073:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9193:Zfp735 UTSW 11 73,580,600 (GRCm39) missense possibly damaging 0.71
R9355:Zfp735 UTSW 11 73,602,362 (GRCm39) missense probably benign 0.01
R9414:Zfp735 UTSW 11 73,602,023 (GRCm39) nonsense probably null
R9456:Zfp735 UTSW 11 73,602,403 (GRCm39) missense possibly damaging 0.53
R9573:Zfp735 UTSW 11 73,602,936 (GRCm39) missense possibly damaging 0.67
R9647:Zfp735 UTSW 11 73,580,600 (GRCm39) missense probably damaging 0.98
R9710:Zfp735 UTSW 11 73,601,806 (GRCm39) missense possibly damaging 0.86
Z1176:Zfp735 UTSW 11 73,601,641 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGGGAATATAGAGCTGGCAG -3'
(R):5'- GCTTCCCATGTGATATATTCCAAG -3'

Sequencing Primer
(F):5'- CTGGCAGTGAAGAGCATGAAATATG -3'
(R):5'- CCCATGTGATATATTCCAAGTTTCAC -3'
Posted On 2019-12-20