Incidental Mutation 'R7866:Zfp735'
ID607794
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7866 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73710803 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 191 (D191A)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably benign
Transcript: ENSMUST00000080407
AA Change: D191A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: D191A

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,098,295 R194* probably null Het
Actl6a A G 3: 32,712,113 T39A possibly damaging Het
Adamts6 T A 13: 104,413,749 C624* probably null Het
Adgrl1 T C 8: 83,937,935 probably null Het
Ap3m2 A G 8: 22,799,658 V143A probably benign Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Aqp5 T A 15: 99,591,543 V91E probably damaging Het
Atp6v0b A T 4: 117,885,153 I181N probably damaging Het
Ccp110 T A 7: 118,723,018 M632K probably benign Het
Cd44 A T 2: 102,842,259 probably null Het
Cidea G A 18: 67,358,784 R38Q probably damaging Het
Cnn3 T C 3: 121,451,393 I86T probably benign Het
Col14a1 C A 15: 55,388,620 D557E unknown Het
Col6a6 T C 9: 105,689,561 Y2245C probably damaging Het
Dhrs4 A T 14: 55,487,635 N196Y probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dpep2 T C 8: 105,989,481 T267A Het
Dtx3l T A 16: 35,938,750 Q43L probably benign Het
Ednrb A G 14: 103,843,302 S59P probably benign Het
Eml4 A G 17: 83,450,697 T435A probably benign Het
Fam135b A T 15: 71,462,076 F1090I probably benign Het
Filip1 A G 9: 79,818,943 V798A probably benign Het
Fnip1 T G 11: 54,465,402 probably benign Het
Gabrb2 C T 11: 42,487,223 Q89* probably null Het
Gm960 T A 19: 4,698,486 R61S unknown Het
Gtf2ird1 A T 5: 134,363,209 V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 M1K probably null Het
Igkv10-96 T A 6: 68,632,041 D90V possibly damaging Het
Igkv4-54 G A 6: 69,631,756 R60C probably benign Het
Igkv7-33 G T 6: 70,058,863 A45D probably damaging Het
Klk1b22 A T 7: 44,112,744 I15F possibly damaging Het
Lamp3 T A 16: 19,699,740 D249V probably benign Het
Lrrfip2 T C 9: 111,193,081 V125A possibly damaging Het
Mprip G A 11: 59,752,930 R638H possibly damaging Het
Muc5ac A G 7: 141,795,852 M501V probably benign Het
Myo5a C T 9: 75,203,752 P1509S probably damaging Het
Ngdn A G 14: 55,021,097 Y63C probably damaging Het
Oit3 A G 10: 59,424,030 V517A probably benign Het
Olfr935 A T 9: 38,994,731 S235T not run Het
Pcdhb18 T A 18: 37,490,459 F281I probably damaging Het
Pkd1 C A 17: 24,590,907 Q3520K probably benign Het
Plxnb1 T A 9: 109,100,457 I127N probably damaging Het
Ppfia2 A T 10: 106,819,529 N319I probably damaging Het
Pxn T C 5: 115,548,606 S386P possibly damaging Het
Ralgps2 C T 1: 156,887,168 V104I probably benign Het
Rp1 C T 1: 4,347,701 V1063I probably benign Het
Slc10a5 A T 3: 10,334,472 F376Y probably damaging Het
Snd1 T A 6: 28,527,725 I277N probably damaging Het
Spc25 A G 2: 69,206,062 probably null Het
Tex29 A G 8: 11,844,055 N6D unknown Het
Ttc30b A G 2: 75,936,619 S597P possibly damaging Het
Ttc6 G A 12: 57,674,649 A975T probably damaging Het
Uba6 T C 5: 86,172,701 E13G probably damaging Het
Ugcg T G 4: 59,211,927 C98G possibly damaging Het
Ugt2b36 T A 5: 87,092,331 D65V probably damaging Het
Unc93b1 A T 19: 3,935,243 D17V not run Het
Usf1 G T 1: 171,417,894 W291C unknown Het
Vps29 T C 5: 122,362,117 W97R possibly damaging Het
Zbtb6 T C 2: 37,429,565 E117G probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73711107 missense possibly damaging 0.86
R7949:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R8005:Zfp735 UTSW 11 73712314 nonsense probably null
Z1176:Zfp735 UTSW 11 73710815 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGGGAATATAGAGCTGGCAG -3'
(R):5'- GCTTCCCATGTGATATATTCCAAG -3'

Sequencing Primer
(F):5'- CTGGCAGTGAAGAGCATGAAATATG -3'
(R):5'- CCCATGTGATATATTCCAAGTTTCAC -3'
Posted On2019-12-20