Incidental Mutation 'R7866:Ttc6'
ID 607795
Institutional Source Beutler Lab
Gene Symbol Ttc6
Ensembl Gene ENSMUSG00000046782
Gene Name tetratricopeptide repeat domain 6
Synonyms LOC217602, Gm9813, EG639426, 4921506M07Rik, AU024163
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 57610899-57784714 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 57721435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 975 (A975T)
Ref Sequence ENSEMBL: ENSMUSP00000134273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172939]
AlphaFold G3UYY4
Predicted Effect probably damaging
Transcript: ENSMUST00000172939
AA Change: A975T

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: A975T

DomainStartEndE-ValueType
coiled coil region 18 42 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
low complexity region 188 212 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
low complexity region 670 685 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
TPR 889 922 2e-4 SMART
TPR 957 989 2.36e1 SMART
TPR 990 1022 2.63e1 SMART
TPR 1023 1056 9.39e-1 SMART
TPR 1057 1090 3.78e-5 SMART
Blast:TPR 1126 1157 1e-11 BLAST
SEL1 1160 1192 3.39e1 SMART
TPR 1160 1194 4.44e1 SMART
TPR 1195 1228 7.87e0 SMART
Blast:TPR 1229 1262 1e-11 BLAST
TPR 1297 1330 1.24e0 SMART
SEL1 1341 1372 9.26e-1 SMART
TPR 1341 1374 3.45e-8 SMART
TPR 1375 1407 8.76e-1 SMART
TPR 1408 1441 1.45e-1 SMART
TPR 1442 1475 1.36e1 SMART
TPR 1476 1509 7.34e-3 SMART
TPR 1513 1546 1.01e0 SMART
TPR 1547 1580 2.55e-2 SMART
TPR 1581 1617 2.43e1 SMART
Blast:TPR 1618 1651 4e-12 BLAST
TPR 1652 1685 7.87e0 SMART
TPR 1686 1718 2.35e-1 SMART
SEL1 1719 1750 1.21e2 SMART
TPR 1719 1752 1.65e-5 SMART
TPR 1753 1786 1.66e-1 SMART
TPR 1787 1820 1.45e-1 SMART
TPR 1821 1854 3.27e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Ttc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03278:Ttc6 APN 12 57,668,812 (GRCm39) missense probably damaging 0.99
polonius UTSW 12 57,704,928 (GRCm39) splice site probably null
tybalt UTSW 12 57,720,542 (GRCm39) missense possibly damaging 0.85
IGL02802:Ttc6 UTSW 12 57,622,654 (GRCm39) missense probably benign 0.14
PIT4802001:Ttc6 UTSW 12 57,772,462 (GRCm39) missense possibly damaging 0.89
R0698:Ttc6 UTSW 12 57,720,002 (GRCm39) missense probably benign 0.04
R0988:Ttc6 UTSW 12 57,735,435 (GRCm39) splice site probably benign
R1290:Ttc6 UTSW 12 57,707,199 (GRCm39) missense probably benign 0.00
R1338:Ttc6 UTSW 12 57,663,155 (GRCm39) missense probably benign 0.10
R1468:Ttc6 UTSW 12 57,721,463 (GRCm39) missense possibly damaging 0.54
R1468:Ttc6 UTSW 12 57,721,463 (GRCm39) missense possibly damaging 0.54
R1481:Ttc6 UTSW 12 57,783,916 (GRCm39) missense probably damaging 1.00
R1488:Ttc6 UTSW 12 57,696,301 (GRCm39) missense possibly damaging 0.66
R1558:Ttc6 UTSW 12 57,733,132 (GRCm39) missense probably benign 0.14
R1570:Ttc6 UTSW 12 57,721,549 (GRCm39) missense probably damaging 0.98
R1619:Ttc6 UTSW 12 57,784,454 (GRCm39) missense possibly damaging 0.73
R1819:Ttc6 UTSW 12 57,741,286 (GRCm39) critical splice donor site probably null
R1826:Ttc6 UTSW 12 57,707,033 (GRCm39) missense probably benign 0.10
R1863:Ttc6 UTSW 12 57,760,881 (GRCm39) missense probably benign 0.04
R1872:Ttc6 UTSW 12 57,751,338 (GRCm39) critical splice donor site probably null
R1887:Ttc6 UTSW 12 57,720,044 (GRCm39) missense probably benign 0.04
R1937:Ttc6 UTSW 12 57,663,109 (GRCm39) missense probably benign 0.02
R2014:Ttc6 UTSW 12 57,623,003 (GRCm39) missense possibly damaging 0.92
R2056:Ttc6 UTSW 12 57,784,479 (GRCm39) missense probably benign 0.08
R2058:Ttc6 UTSW 12 57,784,479 (GRCm39) missense probably benign 0.08
R2059:Ttc6 UTSW 12 57,784,479 (GRCm39) missense probably benign 0.08
R2152:Ttc6 UTSW 12 57,752,338 (GRCm39) missense probably damaging 0.98
R2179:Ttc6 UTSW 12 57,719,904 (GRCm39) missense possibly damaging 0.62
R2275:Ttc6 UTSW 12 57,749,084 (GRCm39) missense probably benign 0.01
R2432:Ttc6 UTSW 12 57,668,821 (GRCm39) missense possibly damaging 0.79
R2474:Ttc6 UTSW 12 57,622,713 (GRCm39) missense probably benign 0.37
R2853:Ttc6 UTSW 12 57,622,967 (GRCm39) missense probably damaging 0.96
R3848:Ttc6 UTSW 12 57,723,932 (GRCm39) missense probably damaging 0.97
R3853:Ttc6 UTSW 12 57,775,335 (GRCm39) missense possibly damaging 0.88
R3950:Ttc6 UTSW 12 57,696,292 (GRCm39) missense probably damaging 0.97
R3953:Ttc6 UTSW 12 57,744,238 (GRCm39) missense probably benign 0.03
R3954:Ttc6 UTSW 12 57,744,238 (GRCm39) missense probably benign 0.03
R3955:Ttc6 UTSW 12 57,744,238 (GRCm39) missense probably benign 0.03
R3957:Ttc6 UTSW 12 57,744,238 (GRCm39) missense probably benign 0.03
R4135:Ttc6 UTSW 12 57,679,581 (GRCm39) intron probably benign
R4387:Ttc6 UTSW 12 57,689,836 (GRCm39) missense probably benign 0.00
R4577:Ttc6 UTSW 12 57,623,441 (GRCm39) missense probably benign 0.22
R4747:Ttc6 UTSW 12 57,721,478 (GRCm39) missense possibly damaging 0.86
R4779:Ttc6 UTSW 12 57,776,237 (GRCm39) missense probably damaging 1.00
R4803:Ttc6 UTSW 12 57,775,291 (GRCm39) missense probably damaging 1.00
R4871:Ttc6 UTSW 12 57,749,142 (GRCm39) missense probably damaging 0.96
R4898:Ttc6 UTSW 12 57,707,026 (GRCm39) missense probably benign 0.00
R4930:Ttc6 UTSW 12 57,720,609 (GRCm39) critical splice donor site probably null
R4946:Ttc6 UTSW 12 57,689,926 (GRCm39) missense probably benign 0.01
R5257:Ttc6 UTSW 12 57,749,061 (GRCm39) missense possibly damaging 0.92
R5303:Ttc6 UTSW 12 57,622,606 (GRCm39) missense possibly damaging 0.90
R5385:Ttc6 UTSW 12 57,689,821 (GRCm39) splice site probably null
R5402:Ttc6 UTSW 12 57,783,817 (GRCm39) nonsense probably null
R5428:Ttc6 UTSW 12 57,736,620 (GRCm39) missense probably null 0.98
R5436:Ttc6 UTSW 12 57,721,380 (GRCm39) splice site probably null
R5646:Ttc6 UTSW 12 57,622,805 (GRCm39) missense probably damaging 0.99
R5697:Ttc6 UTSW 12 57,724,000 (GRCm39) missense probably benign 0.22
R5792:Ttc6 UTSW 12 57,719,990 (GRCm39) missense possibly damaging 0.71
R5808:Ttc6 UTSW 12 57,664,397 (GRCm39) missense possibly damaging 0.84
R5842:Ttc6 UTSW 12 57,783,802 (GRCm39) missense probably damaging 1.00
R5935:Ttc6 UTSW 12 57,720,590 (GRCm39) missense probably damaging 0.98
R6144:Ttc6 UTSW 12 57,719,886 (GRCm39) missense possibly damaging 0.83
R6155:Ttc6 UTSW 12 57,784,402 (GRCm39) missense possibly damaging 0.84
R6283:Ttc6 UTSW 12 57,749,048 (GRCm39) missense possibly damaging 0.95
R6371:Ttc6 UTSW 12 57,775,249 (GRCm39) missense possibly damaging 0.89
R6715:Ttc6 UTSW 12 57,721,556 (GRCm39) critical splice donor site probably null
R6738:Ttc6 UTSW 12 57,735,426 (GRCm39) missense probably damaging 0.99
R6795:Ttc6 UTSW 12 57,751,199 (GRCm39) missense probably damaging 0.96
R6959:Ttc6 UTSW 12 57,704,928 (GRCm39) splice site probably null
R7053:Ttc6 UTSW 12 57,707,318 (GRCm39) missense probably benign 0.01
R7125:Ttc6 UTSW 12 57,623,125 (GRCm39) missense probably benign 0.00
R7259:Ttc6 UTSW 12 57,622,970 (GRCm39) missense probably benign 0.00
R7304:Ttc6 UTSW 12 57,622,837 (GRCm39) missense probably damaging 0.96
R7369:Ttc6 UTSW 12 57,719,717 (GRCm39) critical splice acceptor site probably null
R7409:Ttc6 UTSW 12 57,743,772 (GRCm39) missense probably damaging 0.99
R7429:Ttc6 UTSW 12 57,704,888 (GRCm39) missense probably benign 0.00
R7430:Ttc6 UTSW 12 57,704,888 (GRCm39) missense probably benign 0.00
R7492:Ttc6 UTSW 12 57,719,922 (GRCm39) missense probably benign 0.02
R7535:Ttc6 UTSW 12 57,623,305 (GRCm39) missense probably benign 0.00
R7901:Ttc6 UTSW 12 57,735,353 (GRCm39) missense probably damaging 1.00
R7944:Ttc6 UTSW 12 57,707,229 (GRCm39) missense possibly damaging 0.46
R7945:Ttc6 UTSW 12 57,707,229 (GRCm39) missense possibly damaging 0.46
R7965:Ttc6 UTSW 12 57,720,542 (GRCm39) missense possibly damaging 0.85
R8062:Ttc6 UTSW 12 57,783,764 (GRCm39) missense possibly damaging 0.90
R8119:Ttc6 UTSW 12 57,752,429 (GRCm39) missense possibly damaging 0.78
R8142:Ttc6 UTSW 12 57,744,258 (GRCm39) missense possibly damaging 0.87
R8154:Ttc6 UTSW 12 57,776,210 (GRCm39) missense probably damaging 1.00
R8171:Ttc6 UTSW 12 57,720,096 (GRCm39) missense probably damaging 1.00
R8335:Ttc6 UTSW 12 57,707,077 (GRCm39) missense probably benign 0.00
R8343:Ttc6 UTSW 12 57,707,282 (GRCm39) missense possibly damaging 0.47
R8696:Ttc6 UTSW 12 57,784,492 (GRCm39) missense probably benign 0.20
R8875:Ttc6 UTSW 12 57,776,194 (GRCm39) missense possibly damaging 0.46
R8875:Ttc6 UTSW 12 57,751,199 (GRCm39) missense probably damaging 0.96
R8876:Ttc6 UTSW 12 57,784,489 (GRCm39) missense possibly damaging 0.81
R8924:Ttc6 UTSW 12 57,697,790 (GRCm39) nonsense probably null
R8944:Ttc6 UTSW 12 57,689,826 (GRCm39) missense
R8956:Ttc6 UTSW 12 57,775,196 (GRCm39) nonsense probably null
R9009:Ttc6 UTSW 12 57,744,219 (GRCm39) missense probably damaging 1.00
R9020:Ttc6 UTSW 12 57,752,366 (GRCm39) missense probably damaging 1.00
R9051:Ttc6 UTSW 12 57,783,949 (GRCm39) missense probably damaging 1.00
R9232:Ttc6 UTSW 12 57,776,210 (GRCm39) missense probably damaging 1.00
R9291:Ttc6 UTSW 12 57,622,730 (GRCm39) missense probably damaging 0.99
R9304:Ttc6 UTSW 12 57,776,117 (GRCm39) missense probably damaging 0.99
R9309:Ttc6 UTSW 12 57,753,649 (GRCm39) missense possibly damaging 0.69
R9331:Ttc6 UTSW 12 57,720,509 (GRCm39) missense probably damaging 1.00
R9398:Ttc6 UTSW 12 57,784,404 (GRCm39) nonsense probably null
R9430:Ttc6 UTSW 12 57,733,193 (GRCm39) missense probably damaging 1.00
R9632:Ttc6 UTSW 12 57,664,299 (GRCm39) missense probably benign
R9688:Ttc6 UTSW 12 57,720,602 (GRCm39) missense possibly damaging 0.92
R9732:Ttc6 UTSW 12 57,775,335 (GRCm39) missense probably benign 0.36
R9740:Ttc6 UTSW 12 57,736,496 (GRCm39) missense probably damaging 1.00
R9749:Ttc6 UTSW 12 57,701,559 (GRCm39) missense probably benign 0.00
X0021:Ttc6 UTSW 12 57,622,904 (GRCm39) missense probably damaging 0.96
X0058:Ttc6 UTSW 12 57,753,637 (GRCm39) missense probably damaging 0.99
Z1176:Ttc6 UTSW 12 57,744,161 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATGAGTATTCAGACTCTGAGGGG -3'
(R):5'- TGCCAGCAATGGAAGTTCTG -3'

Sequencing Primer
(F):5'- TTCAGACTCTGAGGGGGAAAATAAG -3'
(R):5'- ACTCTTAAGGGCTTTACAAGGG -3'
Posted On 2019-12-20