Incidental Mutation 'R7866:Adamts6'
ID 607796
Institutional Source Beutler Lab
Gene Symbol Adamts6
Ensembl Gene ENSMUSG00000046169
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms b2b2029Clo, b2b2182Clo, b2b2187.1Clo, b2b1879.1Clo, A930019D11Rik, ADAM-TS6, b2b2228Clo
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.831) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 104424343-104633203 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104550257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 624 (C624*)
Ref Sequence ENSEMBL: ENSMUSP00000064570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065766] [ENSMUST00000223562] [ENSMUST00000224208] [ENSMUST00000224303] [ENSMUST00000224742] [ENSMUST00000224784]
AlphaFold D3Z1A5
Predicted Effect probably null
Transcript: ENSMUST00000065766
AA Change: C624*
SMART Domains Protein: ENSMUSP00000064570
Gene: ENSMUSG00000046169
AA Change: C624*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 191 4.2e-40 PFAM
Pfam:Reprolysin_5 248 443 3.8e-17 PFAM
Pfam:Reprolysin_4 248 464 4.9e-12 PFAM
Pfam:Reprolysin 250 468 1.6e-27 PFAM
Pfam:Reprolysin_2 268 458 5.6e-15 PFAM
Pfam:Reprolysin_3 272 414 2.6e-14 PFAM
TSP1 561 613 3.98e-13 SMART
Pfam:ADAM_spacer1 717 829 2.9e-41 PFAM
TSP1 843 900 2.49e-5 SMART
TSP1 902 960 2.87e-5 SMART
TSP1 963 1018 1.36e-1 SMART
TSP1 1021 1069 2.36e-6 SMART
Pfam:PLAC 1083 1115 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223562
Predicted Effect probably null
Transcript: ENSMUST00000224208
AA Change: C624*
Predicted Effect probably benign
Transcript: ENSMUST00000224303
Predicted Effect probably benign
Transcript: ENSMUST00000224742
Predicted Effect probably benign
Transcript: ENSMUST00000224784
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Expression of this gene may be regulated by the cytokine TNF-alpha. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for induced mutations exhibit cardiovascular defects including double outlet right ventricle, ventricular septal defects and biventricular hypertrophy, and hydrops, thymus hypoplasia short snout and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Adamts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Adamts6 APN 13 104,566,298 (GRCm39) missense possibly damaging 0.79
IGL00583:Adamts6 APN 13 104,433,726 (GRCm39) nonsense probably null
IGL01305:Adamts6 APN 13 104,526,590 (GRCm39) missense probably damaging 1.00
IGL01448:Adamts6 APN 13 104,433,672 (GRCm39) missense probably damaging 1.00
IGL01517:Adamts6 APN 13 104,526,700 (GRCm39) splice site probably benign
IGL01678:Adamts6 APN 13 104,450,196 (GRCm39) missense probably damaging 1.00
IGL01737:Adamts6 APN 13 104,526,643 (GRCm39) missense probably damaging 0.99
IGL02152:Adamts6 APN 13 104,450,168 (GRCm39) missense probably null 1.00
IGL02217:Adamts6 APN 13 104,598,873 (GRCm39) splice site probably benign
IGL02828:Adamts6 APN 13 104,433,978 (GRCm39) missense probably damaging 1.00
IGL03067:Adamts6 APN 13 104,433,783 (GRCm39) missense probably damaging 1.00
IGL03081:Adamts6 APN 13 104,581,464 (GRCm39) utr 3 prime probably benign
IGL03159:Adamts6 APN 13 104,580,723 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts6 APN 13 104,450,842 (GRCm39) missense possibly damaging 0.77
De_vito UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
festinator UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
ANU22:Adamts6 UTSW 13 104,526,590 (GRCm39) missense probably damaging 1.00
P0007:Adamts6 UTSW 13 104,433,999 (GRCm39) missense possibly damaging 0.73
R0362:Adamts6 UTSW 13 104,526,584 (GRCm39) critical splice acceptor site probably null
R0504:Adamts6 UTSW 13 104,563,438 (GRCm39) splice site probably benign
R0549:Adamts6 UTSW 13 104,433,763 (GRCm39) missense possibly damaging 0.60
R0566:Adamts6 UTSW 13 104,581,435 (GRCm39) missense probably benign 0.00
R0703:Adamts6 UTSW 13 104,489,355 (GRCm39) missense probably damaging 1.00
R0799:Adamts6 UTSW 13 104,450,779 (GRCm39) missense probably damaging 1.00
R0838:Adamts6 UTSW 13 104,550,297 (GRCm39) missense possibly damaging 0.47
R1500:Adamts6 UTSW 13 104,449,389 (GRCm39) missense probably damaging 1.00
R1502:Adamts6 UTSW 13 104,630,145 (GRCm39) missense probably damaging 1.00
R1547:Adamts6 UTSW 13 104,581,383 (GRCm39) missense probably benign 0.26
R1619:Adamts6 UTSW 13 104,449,285 (GRCm39) missense probably benign 0.14
R1727:Adamts6 UTSW 13 104,565,472 (GRCm39) splice site probably benign
R1967:Adamts6 UTSW 13 104,563,459 (GRCm39) nonsense probably null
R2013:Adamts6 UTSW 13 104,450,812 (GRCm39) missense probably damaging 0.98
R2079:Adamts6 UTSW 13 104,598,746 (GRCm39) missense probably benign 0.00
R2432:Adamts6 UTSW 13 104,563,485 (GRCm39) missense probably benign 0.01
R3118:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4125:Adamts6 UTSW 13 104,449,412 (GRCm39) missense probably damaging 1.00
R4274:Adamts6 UTSW 13 104,450,787 (GRCm39) missense possibly damaging 0.91
R4795:Adamts6 UTSW 13 104,580,636 (GRCm39) nonsense probably null
R4841:Adamts6 UTSW 13 104,449,295 (GRCm39) missense probably benign 0.00
R4976:Adamts6 UTSW 13 104,433,998 (GRCm39) missense probably damaging 0.98
R5085:Adamts6 UTSW 13 104,443,751 (GRCm39) missense probably damaging 0.99
R5234:Adamts6 UTSW 13 104,630,130 (GRCm39) missense probably damaging 1.00
R5403:Adamts6 UTSW 13 104,489,323 (GRCm39) missense possibly damaging 0.86
R5753:Adamts6 UTSW 13 104,483,858 (GRCm39) missense probably damaging 1.00
R6027:Adamts6 UTSW 13 104,616,043 (GRCm39) missense probably damaging 1.00
R6187:Adamts6 UTSW 13 104,433,933 (GRCm39) missense probably damaging 1.00
R6229:Adamts6 UTSW 13 104,483,900 (GRCm39) critical splice donor site probably null
R6243:Adamts6 UTSW 13 104,450,809 (GRCm39) missense probably damaging 0.99
R6257:Adamts6 UTSW 13 104,598,790 (GRCm39) missense probably benign
R6743:Adamts6 UTSW 13 104,565,436 (GRCm39) missense probably damaging 1.00
R6775:Adamts6 UTSW 13 104,450,160 (GRCm39) missense probably damaging 0.97
R7113:Adamts6 UTSW 13 104,449,267 (GRCm39) missense probably benign
R7351:Adamts6 UTSW 13 104,526,620 (GRCm39) missense possibly damaging 0.63
R7520:Adamts6 UTSW 13 104,433,694 (GRCm39) missense probably benign 0.01
R8274:Adamts6 UTSW 13 104,450,181 (GRCm39) missense probably benign 0.02
R8348:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8448:Adamts6 UTSW 13 104,616,027 (GRCm39) missense probably damaging 0.99
R8686:Adamts6 UTSW 13 104,450,207 (GRCm39) missense probably damaging 1.00
R8691:Adamts6 UTSW 13 104,450,839 (GRCm39) missense probably benign 0.00
R8962:Adamts6 UTSW 13 104,433,899 (GRCm39) missense probably damaging 0.99
R8978:Adamts6 UTSW 13 104,512,247 (GRCm39) missense probably damaging 1.00
R9075:Adamts6 UTSW 13 104,598,793 (GRCm39) missense probably benign
R9080:Adamts6 UTSW 13 104,449,427 (GRCm39) missense probably damaging 1.00
R9152:Adamts6 UTSW 13 104,613,275 (GRCm39) missense probably benign 0.06
R9213:Adamts6 UTSW 13 104,581,440 (GRCm39) missense probably damaging 1.00
R9536:Adamts6 UTSW 13 104,489,313 (GRCm39) missense probably benign 0.07
R9674:Adamts6 UTSW 13 104,563,448 (GRCm39) missense probably benign 0.17
X0065:Adamts6 UTSW 13 104,630,136 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGTGAAGTTCCATGGCAAC -3'
(R):5'- GCTTTGACTAGCAAACACTAACTC -3'

Sequencing Primer
(F):5'- AGTTCCATGGCAACTGCTAG -3'
(R):5'- AGCAAACACTAACTCTAACTAACATG -3'
Posted On 2019-12-20