Incidental Mutation 'R7866:Ngdn'
ID607798
Institutional Source Beutler Lab
Gene Symbol Ngdn
Ensembl Gene ENSMUSG00000022204
Gene Nameneuroguidin, EIF4E binding protein
Synonyms1500001L15Rik, Ngd, neuroguidin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7866 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55015454-55024137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55021097 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000022815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022815]
Predicted Effect probably damaging
Transcript: ENSMUST00000022815
AA Change: Y63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022815
Gene: ENSMUSG00000022204
AA Change: Y63C

DomainStartEndE-ValueType
Pfam:Sas10_Utp3 18 98 1.3e-18 PFAM
low complexity region 142 170 N/A INTRINSIC
low complexity region 296 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,098,295 R194* probably null Het
Actl6a A G 3: 32,712,113 T39A possibly damaging Het
Adamts6 T A 13: 104,413,749 C624* probably null Het
Adgrl1 T C 8: 83,937,935 probably null Het
Ap3m2 A G 8: 22,799,658 V143A probably benign Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Aqp5 T A 15: 99,591,543 V91E probably damaging Het
Atp6v0b A T 4: 117,885,153 I181N probably damaging Het
Ccp110 T A 7: 118,723,018 M632K probably benign Het
Cd44 A T 2: 102,842,259 probably null Het
Cidea G A 18: 67,358,784 R38Q probably damaging Het
Cnn3 T C 3: 121,451,393 I86T probably benign Het
Col14a1 C A 15: 55,388,620 D557E unknown Het
Col6a6 T C 9: 105,689,561 Y2245C probably damaging Het
Dhrs4 A T 14: 55,487,635 N196Y probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dpep2 T C 8: 105,989,481 T267A Het
Dtx3l T A 16: 35,938,750 Q43L probably benign Het
Ednrb A G 14: 103,843,302 S59P probably benign Het
Eml4 A G 17: 83,450,697 T435A probably benign Het
Fam135b A T 15: 71,462,076 F1090I probably benign Het
Filip1 A G 9: 79,818,943 V798A probably benign Het
Fnip1 T G 11: 54,465,402 probably benign Het
Gabrb2 C T 11: 42,487,223 Q89* probably null Het
Gm960 T A 19: 4,698,486 R61S unknown Het
Gtf2ird1 A T 5: 134,363,209 V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 M1K probably null Het
Igkv10-96 T A 6: 68,632,041 D90V possibly damaging Het
Igkv4-54 G A 6: 69,631,756 R60C probably benign Het
Igkv7-33 G T 6: 70,058,863 A45D probably damaging Het
Klk1b22 A T 7: 44,112,744 I15F possibly damaging Het
Lamp3 T A 16: 19,699,740 D249V probably benign Het
Lrrfip2 T C 9: 111,193,081 V125A possibly damaging Het
Mprip G A 11: 59,752,930 R638H possibly damaging Het
Muc5ac A G 7: 141,795,852 M501V probably benign Het
Myo5a C T 9: 75,203,752 P1509S probably damaging Het
Oit3 A G 10: 59,424,030 V517A probably benign Het
Olfr935 A T 9: 38,994,731 S235T not run Het
Pcdhb18 T A 18: 37,490,459 F281I probably damaging Het
Pkd1 C A 17: 24,590,907 Q3520K probably benign Het
Plxnb1 T A 9: 109,100,457 I127N probably damaging Het
Ppfia2 A T 10: 106,819,529 N319I probably damaging Het
Pxn T C 5: 115,548,606 S386P possibly damaging Het
Ralgps2 C T 1: 156,887,168 V104I probably benign Het
Rp1 C T 1: 4,347,701 V1063I probably benign Het
Slc10a5 A T 3: 10,334,472 F376Y probably damaging Het
Snd1 T A 6: 28,527,725 I277N probably damaging Het
Spc25 A G 2: 69,206,062 probably null Het
Tex29 A G 8: 11,844,055 N6D unknown Het
Ttc30b A G 2: 75,936,619 S597P possibly damaging Het
Ttc6 G A 12: 57,674,649 A975T probably damaging Het
Uba6 T C 5: 86,172,701 E13G probably damaging Het
Ugcg T G 4: 59,211,927 C98G possibly damaging Het
Ugt2b36 T A 5: 87,092,331 D65V probably damaging Het
Unc93b1 A T 19: 3,935,243 D17V not run Het
Usf1 G T 1: 171,417,894 W291C unknown Het
Vps29 T C 5: 122,362,117 W97R possibly damaging Het
Zbtb6 T C 2: 37,429,565 E117G probably damaging Het
Zfp735 A C 11: 73,710,803 D191A probably benign Het
Other mutations in Ngdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ngdn APN 14 55023169 missense probably damaging 0.99
IGL01301:Ngdn APN 14 55017114 missense probably benign 0.15
IGL02350:Ngdn APN 14 55021936 missense probably damaging 1.00
IGL02357:Ngdn APN 14 55021936 missense probably damaging 1.00
ANU18:Ngdn UTSW 14 55017114 missense probably benign 0.15
PIT4651001:Ngdn UTSW 14 55016200 missense probably benign 0.05
R2062:Ngdn UTSW 14 55022107 missense possibly damaging 0.93
R2251:Ngdn UTSW 14 55023395 critical splice donor site probably null
R5167:Ngdn UTSW 14 55022199 nonsense probably null
R5492:Ngdn UTSW 14 55023052 missense probably benign 0.00
R6174:Ngdn UTSW 14 55022099 missense probably benign 0.38
R6712:Ngdn UTSW 14 55016188 missense probably benign 0.18
R8303:Ngdn UTSW 14 55023145 missense probably benign 0.01
X0025:Ngdn UTSW 14 55021915 missense possibly damaging 0.71
Z1177:Ngdn UTSW 14 55021944 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGACAGTTGACCTGGG -3'
(R):5'- TAGAGCAATTGTGGACGAAAACATC -3'

Sequencing Primer
(F):5'- AGCATTTGCATTGTGGGTACACC -3'
(R):5'- TGTGGACGAAAACATCTCCTTAC -3'
Posted On2019-12-20