Incidental Mutation 'R7866:Col14a1'
ID 607801
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Name collagen, type XIV, alpha 1
Synonyms 5730412L22Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 55171146-55384199 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55252016 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 557 (D557E)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
AlphaFold Q80X19
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: D557E
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: D557E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: D557E
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: D557E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: D557E
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: D557E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Eml4 A G 17: 83,758,126 (GRCm39) T435A probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55,274,981 (GRCm39) missense unknown
IGL01290:Col14a1 APN 15 55,286,903 (GRCm39) missense unknown
IGL01300:Col14a1 APN 15 55,331,372 (GRCm39) missense unknown
IGL01505:Col14a1 APN 15 55,318,619 (GRCm39) missense unknown
IGL01533:Col14a1 APN 15 55,284,236 (GRCm39) missense unknown
IGL01563:Col14a1 APN 15 55,351,337 (GRCm39) missense unknown
IGL01650:Col14a1 APN 15 55,270,089 (GRCm39) missense unknown
IGL01659:Col14a1 APN 15 55,309,568 (GRCm39) unclassified probably benign
IGL01670:Col14a1 APN 15 55,192,662 (GRCm39) missense unknown
IGL01760:Col14a1 APN 15 55,286,855 (GRCm39) missense unknown
IGL01803:Col14a1 APN 15 55,282,210 (GRCm39) missense unknown
IGL01966:Col14a1 APN 15 55,312,121 (GRCm39) unclassified probably benign
IGL01990:Col14a1 APN 15 55,226,859 (GRCm39) missense unknown
IGL02124:Col14a1 APN 15 55,327,099 (GRCm39) missense unknown
IGL02138:Col14a1 APN 15 55,284,231 (GRCm39) missense unknown
IGL02192:Col14a1 APN 15 55,225,798 (GRCm39) missense unknown
IGL02326:Col14a1 APN 15 55,282,193 (GRCm39) missense unknown
IGL02335:Col14a1 APN 15 55,327,165 (GRCm39) splice site probably benign
IGL02407:Col14a1 APN 15 55,312,272 (GRCm39) splice site probably benign
IGL02486:Col14a1 APN 15 55,252,092 (GRCm39) splice site probably benign
IGL02537:Col14a1 APN 15 55,208,310 (GRCm39) nonsense probably null
IGL02567:Col14a1 APN 15 55,208,357 (GRCm39) critical splice donor site probably null
IGL02643:Col14a1 APN 15 55,284,258 (GRCm39) missense unknown
IGL02669:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL02673:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL02674:Col14a1 APN 15 55,282,178 (GRCm39) missense unknown
IGL03201:Col14a1 APN 15 55,272,300 (GRCm39) missense unknown
IGL03334:Col14a1 APN 15 55,312,217 (GRCm39) unclassified probably benign
IGL03370:Col14a1 APN 15 55,351,937 (GRCm39) splice site probably null
IGL03385:Col14a1 APN 15 55,273,600 (GRCm39) missense unknown
IGL03385:Col14a1 APN 15 55,335,104 (GRCm39) missense unknown
PIT4131001:Col14a1 UTSW 15 55,312,272 (GRCm39) splice site probably benign
R0046:Col14a1 UTSW 15 55,272,359 (GRCm39) splice site probably benign
R0046:Col14a1 UTSW 15 55,272,359 (GRCm39) splice site probably benign
R0173:Col14a1 UTSW 15 55,351,928 (GRCm39) missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55,360,907 (GRCm39) missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55,360,907 (GRCm39) missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55,271,264 (GRCm39) splice site probably benign
R0391:Col14a1 UTSW 15 55,309,655 (GRCm39) unclassified probably benign
R0468:Col14a1 UTSW 15 55,252,042 (GRCm39) missense unknown
R0652:Col14a1 UTSW 15 55,208,278 (GRCm39) missense unknown
R0692:Col14a1 UTSW 15 55,205,134 (GRCm39) missense unknown
R0745:Col14a1 UTSW 15 55,201,813 (GRCm39) missense unknown
R1006:Col14a1 UTSW 15 55,383,331 (GRCm39) missense probably benign 0.04
R1331:Col14a1 UTSW 15 55,273,584 (GRCm39) missense unknown
R1537:Col14a1 UTSW 15 55,244,163 (GRCm39) missense unknown
R1557:Col14a1 UTSW 15 55,251,975 (GRCm39) missense unknown
R1721:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1737:Col14a1 UTSW 15 55,208,357 (GRCm39) critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55,245,891 (GRCm39) missense unknown
R1867:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1868:Col14a1 UTSW 15 55,310,858 (GRCm39) unclassified probably benign
R1991:Col14a1 UTSW 15 55,313,336 (GRCm39) missense unknown
R2020:Col14a1 UTSW 15 55,309,577 (GRCm39) unclassified probably benign
R2103:Col14a1 UTSW 15 55,313,336 (GRCm39) missense unknown
R2116:Col14a1 UTSW 15 55,271,160 (GRCm39) missense unknown
R2163:Col14a1 UTSW 15 55,308,041 (GRCm39) unclassified probably benign
R2207:Col14a1 UTSW 15 55,327,082 (GRCm39) missense unknown
R2215:Col14a1 UTSW 15 55,244,238 (GRCm39) missense unknown
R2264:Col14a1 UTSW 15 55,330,086 (GRCm39) splice site probably null
R2383:Col14a1 UTSW 15 55,310,913 (GRCm39) unclassified probably benign
R2397:Col14a1 UTSW 15 55,201,835 (GRCm39) missense unknown
R2422:Col14a1 UTSW 15 55,313,318 (GRCm39) missense unknown
R3793:Col14a1 UTSW 15 55,226,909 (GRCm39) missense unknown
R4082:Col14a1 UTSW 15 55,300,429 (GRCm39) missense unknown
R4112:Col14a1 UTSW 15 55,226,955 (GRCm39) missense unknown
R4519:Col14a1 UTSW 15 55,251,975 (GRCm39) missense unknown
R4628:Col14a1 UTSW 15 55,313,229 (GRCm39) nonsense probably null
R4692:Col14a1 UTSW 15 55,286,864 (GRCm39) missense unknown
R4696:Col14a1 UTSW 15 55,235,998 (GRCm39) missense unknown
R4749:Col14a1 UTSW 15 55,315,732 (GRCm39) missense unknown
R5324:Col14a1 UTSW 15 55,201,841 (GRCm39) missense unknown
R5382:Col14a1 UTSW 15 55,225,832 (GRCm39) missense unknown
R5634:Col14a1 UTSW 15 55,381,694 (GRCm39) missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55,286,908 (GRCm39) missense unknown
R5828:Col14a1 UTSW 15 55,300,372 (GRCm39) missense unknown
R5873:Col14a1 UTSW 15 55,309,182 (GRCm39) unclassified probably benign
R5966:Col14a1 UTSW 15 55,315,779 (GRCm39) critical splice donor site probably null
R6106:Col14a1 UTSW 15 55,383,404 (GRCm39) missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55,244,246 (GRCm39) missense unknown
R6319:Col14a1 UTSW 15 55,379,565 (GRCm39) missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55,309,218 (GRCm39) unclassified probably benign
R6540:Col14a1 UTSW 15 55,235,977 (GRCm39) missense unknown
R6893:Col14a1 UTSW 15 55,308,044 (GRCm39) unclassified probably benign
R6992:Col14a1 UTSW 15 55,274,958 (GRCm39) splice site probably null
R7284:Col14a1 UTSW 15 55,381,715 (GRCm39) missense probably damaging 1.00
R7404:Col14a1 UTSW 15 55,252,024 (GRCm39) nonsense probably null
R7655:Col14a1 UTSW 15 55,225,846 (GRCm39) missense unknown
R7656:Col14a1 UTSW 15 55,225,846 (GRCm39) missense unknown
R7715:Col14a1 UTSW 15 55,351,379 (GRCm39) missense unknown
R7841:Col14a1 UTSW 15 55,245,876 (GRCm39) missense unknown
R7861:Col14a1 UTSW 15 55,308,012 (GRCm39) missense unknown
R7902:Col14a1 UTSW 15 55,364,832 (GRCm39) missense probably benign 0.16
R8041:Col14a1 UTSW 15 55,318,626 (GRCm39) missense unknown
R8159:Col14a1 UTSW 15 55,291,324 (GRCm39) missense unknown
R8224:Col14a1 UTSW 15 55,271,137 (GRCm39) missense unknown
R8282:Col14a1 UTSW 15 55,284,276 (GRCm39) missense unknown
R8729:Col14a1 UTSW 15 55,310,893 (GRCm39) nonsense probably null
R8737:Col14a1 UTSW 15 55,318,706 (GRCm39) nonsense probably null
R8871:Col14a1 UTSW 15 55,245,958 (GRCm39) missense unknown
R9069:Col14a1 UTSW 15 55,251,990 (GRCm39) missense unknown
R9081:Col14a1 UTSW 15 55,291,387 (GRCm39) missense unknown
R9088:Col14a1 UTSW 15 55,226,923 (GRCm39) missense unknown
R9113:Col14a1 UTSW 15 55,201,825 (GRCm39) missense unknown
R9193:Col14a1 UTSW 15 55,242,964 (GRCm39) missense unknown
R9274:Col14a1 UTSW 15 55,381,671 (GRCm39) missense probably damaging 0.99
R9288:Col14a1 UTSW 15 55,286,918 (GRCm39) missense unknown
R9320:Col14a1 UTSW 15 55,364,780 (GRCm39) missense probably benign 0.16
R9602:Col14a1 UTSW 15 55,351,345 (GRCm39) missense unknown
R9620:Col14a1 UTSW 15 55,225,781 (GRCm39) missense unknown
R9629:Col14a1 UTSW 15 55,382,545 (GRCm39) missense
X0023:Col14a1 UTSW 15 55,286,843 (GRCm39) missense unknown
X0063:Col14a1 UTSW 15 55,273,611 (GRCm39) missense unknown
Z1177:Col14a1 UTSW 15 55,235,966 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CGAGAGGATTCATCACGTATTTTG -3'
(R):5'- GACTCTCATGAGCGCTTAGC -3'

Sequencing Primer
(F):5'- TCACGTATTTTGAGATTATACCGTC -3'
(R):5'- CGCTTAGCTTGTAGAGACTGCAC -3'
Posted On 2019-12-20