Incidental Mutation 'R7866:Fam135b'
ID607802
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7866 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71462076 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1090 (F1090I)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably benign
Transcript: ENSMUST00000022953
AA Change: F1090I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: F1090I

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,098,295 R194* probably null Het
Actl6a A G 3: 32,712,113 T39A possibly damaging Het
Adamts6 T A 13: 104,413,749 C624* probably null Het
Adgrl1 T C 8: 83,937,935 probably null Het
Ap3m2 A G 8: 22,799,658 V143A probably benign Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Aqp5 T A 15: 99,591,543 V91E probably damaging Het
Atp6v0b A T 4: 117,885,153 I181N probably damaging Het
Ccp110 T A 7: 118,723,018 M632K probably benign Het
Cd44 A T 2: 102,842,259 probably null Het
Cidea G A 18: 67,358,784 R38Q probably damaging Het
Cnn3 T C 3: 121,451,393 I86T probably benign Het
Col14a1 C A 15: 55,388,620 D557E unknown Het
Col6a6 T C 9: 105,689,561 Y2245C probably damaging Het
Dhrs4 A T 14: 55,487,635 N196Y probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dpep2 T C 8: 105,989,481 T267A Het
Dtx3l T A 16: 35,938,750 Q43L probably benign Het
Ednrb A G 14: 103,843,302 S59P probably benign Het
Eml4 A G 17: 83,450,697 T435A probably benign Het
Filip1 A G 9: 79,818,943 V798A probably benign Het
Fnip1 T G 11: 54,465,402 probably benign Het
Gabrb2 C T 11: 42,487,223 Q89* probably null Het
Gm960 T A 19: 4,698,486 R61S unknown Het
Gtf2ird1 A T 5: 134,363,209 V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 M1K probably null Het
Igkv10-96 T A 6: 68,632,041 D90V possibly damaging Het
Igkv4-54 G A 6: 69,631,756 R60C probably benign Het
Igkv7-33 G T 6: 70,058,863 A45D probably damaging Het
Klk1b22 A T 7: 44,112,744 I15F possibly damaging Het
Lamp3 T A 16: 19,699,740 D249V probably benign Het
Lrrfip2 T C 9: 111,193,081 V125A possibly damaging Het
Mprip G A 11: 59,752,930 R638H possibly damaging Het
Muc5ac A G 7: 141,795,852 M501V probably benign Het
Myo5a C T 9: 75,203,752 P1509S probably damaging Het
Ngdn A G 14: 55,021,097 Y63C probably damaging Het
Oit3 A G 10: 59,424,030 V517A probably benign Het
Olfr935 A T 9: 38,994,731 S235T not run Het
Pcdhb18 T A 18: 37,490,459 F281I probably damaging Het
Pkd1 C A 17: 24,590,907 Q3520K probably benign Het
Plxnb1 T A 9: 109,100,457 I127N probably damaging Het
Ppfia2 A T 10: 106,819,529 N319I probably damaging Het
Pxn T C 5: 115,548,606 S386P possibly damaging Het
Ralgps2 C T 1: 156,887,168 V104I probably benign Het
Rp1 C T 1: 4,347,701 V1063I probably benign Het
Slc10a5 A T 3: 10,334,472 F376Y probably damaging Het
Snd1 T A 6: 28,527,725 I277N probably damaging Het
Spc25 A G 2: 69,206,062 probably null Het
Tex29 A G 8: 11,844,055 N6D unknown Het
Ttc30b A G 2: 75,936,619 S597P possibly damaging Het
Ttc6 G A 12: 57,674,649 A975T probably damaging Het
Uba6 T C 5: 86,172,701 E13G probably damaging Het
Ugcg T G 4: 59,211,927 C98G possibly damaging Het
Ugt2b36 T A 5: 87,092,331 D65V probably damaging Het
Unc93b1 A T 19: 3,935,243 D17V not run Het
Usf1 G T 1: 171,417,894 W291C unknown Het
Vps29 T C 5: 122,362,117 W97R possibly damaging Het
Zbtb6 T C 2: 37,429,565 E117G probably damaging Het
Zfp735 A C 11: 73,710,803 D191A probably benign Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
R8167:Fam135b UTSW 15 71532991 missense probably null 1.00
R8252:Fam135b UTSW 15 71533023 missense probably benign 0.10
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- CATTCAGCTGATATGTTAGGAGATGG -3'
(R):5'- CCTGAAGGCAGTGGAAGTTG -3'

Sequencing Primer
(F):5'- GAAGTGCATGACATGAACA -3'
(R):5'- CCTGAAGGCAGTGGAAGTTGTTAAC -3'
Posted On2019-12-20