Incidental Mutation 'R7866:Eml4'
ID 607809
Institutional Source Beutler Lab
Gene Symbol Eml4
Ensembl Gene ENSMUSG00000032624
Gene Name echinoderm microtubule associated protein like 4
Synonyms 4930443C24Rik
MMRRC Submission 045918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.887) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 83658360-83787790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83758126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 435 (T435A)
Ref Sequence ENSEMBL: ENSMUSP00000094528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000049503
AA Change: T323A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624
AA Change: T323A

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 197 246 1.79e-1 SMART
Blast:WD40 252 294 3e-19 BLAST
WD40 297 336 5.97e-1 SMART
WD40 345 382 2.96e1 SMART
low complexity region 388 396 N/A INTRINSIC
WD40 397 436 1.48e-2 SMART
WD40 480 519 4.95e-4 SMART
WD40 522 560 7.92e1 SMART
WD40 563 602 5.75e-1 SMART
WD40 609 648 2.69e-5 SMART
WD40 722 762 8.04e-4 SMART
low complexity region 793 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096766
AA Change: T435A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: T435A

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
low complexity region 137 155 N/A INTRINSIC
Pfam:HELP 236 308 1.1e-33 PFAM
WD40 309 358 1.79e-1 SMART
Blast:WD40 364 406 4e-20 BLAST
WD40 409 448 5.97e-1 SMART
WD40 457 494 2.96e1 SMART
low complexity region 500 508 N/A INTRINSIC
WD40 509 548 1.48e-2 SMART
WD40 592 631 4.95e-4 SMART
WD40 634 672 7.92e1 SMART
WD40 675 714 5.75e-1 SMART
WD40 721 760 2.69e-5 SMART
WD40 834 874 8.04e-4 SMART
low complexity region 905 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112363
AA Change: T366A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624
AA Change: T366A

DomainStartEndE-ValueType
coiled coil region 15 53 N/A INTRINSIC
WD40 240 289 1.79e-1 SMART
Blast:WD40 295 337 3e-19 BLAST
WD40 340 379 5.97e-1 SMART
WD40 388 425 2.96e1 SMART
low complexity region 431 439 N/A INTRINSIC
WD40 440 479 1.48e-2 SMART
WD40 523 562 4.95e-4 SMART
WD40 565 603 7.92e1 SMART
WD40 606 645 5.75e-1 SMART
WD40 652 691 2.69e-5 SMART
WD40 765 805 8.04e-4 SMART
low complexity region 836 848 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,317,269 (GRCm39) R194* probably null Het
Actl6a A G 3: 32,766,262 (GRCm39) T39A possibly damaging Het
Adamts6 T A 13: 104,550,257 (GRCm39) C624* probably null Het
Adgrl1 T C 8: 84,664,564 (GRCm39) probably null Het
Ap3m2 A G 8: 23,289,674 (GRCm39) V143A probably benign Het
Ap5m1 T C 14: 49,311,218 (GRCm39) V96A probably damaging Het
Aqp5 T A 15: 99,489,424 (GRCm39) V91E probably damaging Het
Atp6v0b A T 4: 117,742,350 (GRCm39) I181N probably damaging Het
Ccp110 T A 7: 118,322,241 (GRCm39) M632K probably benign Het
Cd44 A T 2: 102,672,604 (GRCm39) probably null Het
Cidea G A 18: 67,491,854 (GRCm39) R38Q probably damaging Het
Cnn3 T C 3: 121,245,042 (GRCm39) I86T probably benign Het
Col14a1 C A 15: 55,252,016 (GRCm39) D557E unknown Het
Col6a6 T C 9: 105,566,760 (GRCm39) Y2245C probably damaging Het
Dhrs4 A T 14: 55,725,092 (GRCm39) N196Y probably damaging Het
Dnah8 T C 17: 31,093,901 (GRCm39) V4665A possibly damaging Het
Dpep2 T C 8: 106,716,113 (GRCm39) T267A Het
Dtx3l T A 16: 35,759,120 (GRCm39) Q43L probably benign Het
Ednrb A G 14: 104,080,738 (GRCm39) S59P probably benign Het
Fam135b A T 15: 71,333,925 (GRCm39) F1090I probably benign Het
Filip1 A G 9: 79,726,225 (GRCm39) V798A probably benign Het
Fnip1 T G 11: 54,356,228 (GRCm39) probably benign Het
Gabrb2 C T 11: 42,378,050 (GRCm39) Q89* probably null Het
Gtf2ird1 A T 5: 134,392,063 (GRCm39) V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 (GRCm39) M1K probably null Het
Ift70b A G 2: 75,766,963 (GRCm39) S597P possibly damaging Het
Igkv10-96 T A 6: 68,609,025 (GRCm39) D90V possibly damaging Het
Igkv4-54 G A 6: 69,608,740 (GRCm39) R60C probably benign Het
Igkv7-33 G T 6: 70,035,847 (GRCm39) A45D probably damaging Het
Klk1b22 A T 7: 43,762,168 (GRCm39) I15F possibly damaging Het
Lamp3 T A 16: 19,518,490 (GRCm39) D249V probably benign Het
Lrrfip2 T C 9: 111,022,149 (GRCm39) V125A possibly damaging Het
Mprip G A 11: 59,643,756 (GRCm39) R638H possibly damaging Het
Muc5ac A G 7: 141,349,589 (GRCm39) M501V probably benign Het
Myo5a C T 9: 75,111,034 (GRCm39) P1509S probably damaging Het
Ngdn A G 14: 55,258,554 (GRCm39) Y63C probably damaging Het
Oit3 A G 10: 59,259,852 (GRCm39) V517A probably benign Het
Or8g21 A T 9: 38,906,027 (GRCm39) S235T not run Het
Pcdhb18 T A 18: 37,623,512 (GRCm39) F281I probably damaging Het
Pkd1 C A 17: 24,809,881 (GRCm39) Q3520K probably benign Het
Plxnb1 T A 9: 108,929,525 (GRCm39) I127N probably damaging Het
Ppfia2 A T 10: 106,655,390 (GRCm39) N319I probably damaging Het
Pxn T C 5: 115,686,665 (GRCm39) S386P possibly damaging Het
Ralgps2 C T 1: 156,714,738 (GRCm39) V104I probably benign Het
Rp1 C T 1: 4,417,924 (GRCm39) V1063I probably benign Het
Slc10a5 A T 3: 10,399,532 (GRCm39) F376Y probably damaging Het
Snd1 T A 6: 28,527,724 (GRCm39) I277N probably damaging Het
Spc25 A G 2: 69,036,406 (GRCm39) probably null Het
Tex29 A G 8: 11,894,055 (GRCm39) N6D unknown Het
Top6bl T A 19: 4,748,514 (GRCm39) R61S unknown Het
Ttc6 G A 12: 57,721,435 (GRCm39) A975T probably damaging Het
Uba6 T C 5: 86,320,560 (GRCm39) E13G probably damaging Het
Ugcg T G 4: 59,211,927 (GRCm39) C98G possibly damaging Het
Ugt2b36 T A 5: 87,240,190 (GRCm39) D65V probably damaging Het
Unc93b1 A T 19: 3,985,243 (GRCm39) D17V not run Het
Usf1 G T 1: 171,245,462 (GRCm39) W291C unknown Het
Vps29 T C 5: 122,500,180 (GRCm39) W97R possibly damaging Het
Zbtb6 T C 2: 37,319,577 (GRCm39) E117G probably damaging Het
Zfp735 A C 11: 73,601,629 (GRCm39) D191A probably benign Het
Other mutations in Eml4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Eml4 APN 17 83,755,613 (GRCm39) missense probably benign 0.05
IGL00815:Eml4 APN 17 83,758,219 (GRCm39) splice site probably benign
IGL01969:Eml4 APN 17 83,753,409 (GRCm39) missense possibly damaging 0.95
IGL02005:Eml4 APN 17 83,785,132 (GRCm39) splice site probably benign
IGL02273:Eml4 APN 17 83,763,808 (GRCm39) splice site probably null
IGL02318:Eml4 APN 17 83,748,795 (GRCm39) missense probably benign 0.01
IGL02421:Eml4 APN 17 83,785,321 (GRCm39) missense probably benign 0.00
IGL02728:Eml4 APN 17 83,780,568 (GRCm39) splice site probably null
IGL02814:Eml4 APN 17 83,748,791 (GRCm39) nonsense probably null
IGL02900:Eml4 APN 17 83,785,421 (GRCm39) missense probably benign 0.00
IGL03205:Eml4 APN 17 83,761,873 (GRCm39) missense probably damaging 1.00
erring UTSW 17 83,755,646 (GRCm39) missense probably damaging 1.00
R0147:Eml4 UTSW 17 83,729,081 (GRCm39) missense probably damaging 1.00
R0148:Eml4 UTSW 17 83,729,081 (GRCm39) missense probably damaging 1.00
R0440:Eml4 UTSW 17 83,753,487 (GRCm39) critical splice donor site probably null
R0541:Eml4 UTSW 17 83,747,471 (GRCm39) missense probably benign 0.00
R0645:Eml4 UTSW 17 83,770,922 (GRCm39) splice site probably benign
R0733:Eml4 UTSW 17 83,761,893 (GRCm39) missense possibly damaging 0.88
R0944:Eml4 UTSW 17 83,785,489 (GRCm39) missense probably benign 0.08
R1071:Eml4 UTSW 17 83,785,468 (GRCm39) nonsense probably null
R1975:Eml4 UTSW 17 83,717,622 (GRCm39) missense probably benign 0.00
R2042:Eml4 UTSW 17 83,755,607 (GRCm39) missense probably damaging 0.97
R2229:Eml4 UTSW 17 83,758,485 (GRCm39) missense probably benign 0.05
R2257:Eml4 UTSW 17 83,785,189 (GRCm39) missense probably damaging 0.99
R2878:Eml4 UTSW 17 83,717,603 (GRCm39) missense probably benign 0.01
R3820:Eml4 UTSW 17 83,780,494 (GRCm39) missense probably damaging 1.00
R4466:Eml4 UTSW 17 83,729,103 (GRCm39) nonsense probably null
R4620:Eml4 UTSW 17 83,768,962 (GRCm39) missense probably benign 0.13
R4657:Eml4 UTSW 17 83,758,377 (GRCm39) nonsense probably null
R4717:Eml4 UTSW 17 83,755,654 (GRCm39) missense probably benign 0.38
R4740:Eml4 UTSW 17 83,717,459 (GRCm39) missense probably damaging 1.00
R5073:Eml4 UTSW 17 83,771,006 (GRCm39) missense probably damaging 1.00
R5699:Eml4 UTSW 17 83,717,514 (GRCm39) missense probably benign 0.16
R5834:Eml4 UTSW 17 83,785,170 (GRCm39) missense probably damaging 1.00
R5944:Eml4 UTSW 17 83,753,472 (GRCm39) missense possibly damaging 0.52
R6044:Eml4 UTSW 17 83,753,379 (GRCm39) missense probably damaging 1.00
R6378:Eml4 UTSW 17 83,755,646 (GRCm39) missense probably damaging 1.00
R6980:Eml4 UTSW 17 83,758,446 (GRCm39) missense probably benign 0.00
R7025:Eml4 UTSW 17 83,732,740 (GRCm39) missense probably benign 0.04
R7037:Eml4 UTSW 17 83,732,756 (GRCm39) missense probably benign 0.04
R7042:Eml4 UTSW 17 83,768,999 (GRCm39) missense probably damaging 0.99
R7192:Eml4 UTSW 17 83,761,890 (GRCm39) missense probably benign 0.01
R7525:Eml4 UTSW 17 83,753,379 (GRCm39) missense probably damaging 1.00
R7548:Eml4 UTSW 17 83,732,766 (GRCm39) missense probably benign 0.18
R7595:Eml4 UTSW 17 83,763,513 (GRCm39) missense probably benign 0.18
R7791:Eml4 UTSW 17 83,781,135 (GRCm39) missense probably benign 0.45
R7936:Eml4 UTSW 17 83,781,115 (GRCm39) missense possibly damaging 0.65
R8435:Eml4 UTSW 17 83,729,070 (GRCm39) missense possibly damaging 0.78
R8447:Eml4 UTSW 17 83,755,656 (GRCm39) missense probably damaging 0.99
R8698:Eml4 UTSW 17 83,785,345 (GRCm39) missense probably benign
R9026:Eml4 UTSW 17 83,764,479 (GRCm39) missense probably damaging 0.99
R9054:Eml4 UTSW 17 83,734,640 (GRCm39) splice site probably benign
R9630:Eml4 UTSW 17 83,717,572 (GRCm39) missense probably damaging 1.00
R9765:Eml4 UTSW 17 83,747,498 (GRCm39) missense probably damaging 1.00
Z1176:Eml4 UTSW 17 83,753,394 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTTCCCAAATATGTAAGACG -3'
(R):5'- TGGCATGGTGATTTTATACTTACCC -3'

Sequencing Primer
(F):5'- CTTTCCCAAATATGTAAGACGTAAGC -3'
(R):5'- ACAGTCTGATCCTTACCC -3'
Posted On 2019-12-20